IMGT/JunctionAnalysis Documentation

http://www.imgt.org

Citing IMGT/JunctionAnalysis: Yousfi Monod, M. et al., Bioinformatics, 20, i379-i385 (2004). PMID: 15262823. Giudicelli, V., Lefranc, M.-P., Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.prot5634. doi: 10.1101/pdb.prot5634. PMID: 21632777 Abstract also in IMGT booklet with generous provision from Cold Spring Harbor (CSH) Protocols (high res) (lower res)

IMGT/JunctionAnalysis programme version
IMGT/JunctionAnalysis reference directory release

Table of contents

• Introduction
• IMGT/JunctionAnalysis Search page
  • Selection
  • JUNCTION nucleotide sequences
  • Example of IMGT/JunctionAnalysis results
  • Display Results
  • Advanced parameters

• IMGT/JunctionAnalysis Results
  • Brief summary
  • Analysis of the JUNCTION
  • JUNCTION alignments with translation and IMGT AA classes
  • List of junctions with no results
• Comparison between IMGT/JunctionAnalysis and IMGT/V-QUEST results

Introduction

• analyses junction nucleotide sequences of rearranged IG (IGH, IGK or IGL) and TR (TRA, TRB, TRG or TRD) genes,
• identifies accurately D-GENE and ALLELE in the IGH, TRB and TRD junctions,
• delimits precisely the different regions of the junctions: 3'V-REGION, D-REGION(s), 5'J-REGION, as well as N-REGION(s) and P-REGION(s).
• determines the number of mutations in the 3'V-REGION, D-REGION and 5'J-REGION of the IG JUNCTIONs.
• calculates the "gc" content of the N-REGIONs of the IG and TR JUNCTIONs.

IMGT/JunctionAnalysis Welcome page

The IMGT/JunctionAnalysis Welcome page allows to enter the input information.

1. Selection:
   • Species (drop-down list).
   • Locus (radio buttons): IGH, IGK, IGL, TRA, TRB, TRG, TRD
The analysis of IG and TR junctions of mice and humans can be performed exhaustively. Analysis of junctions of other species (rat, rabbit, trout) becomes progressively more available as genomic sequences are annotated in IMGT.
2. JUNCTION nucleotide sequences:
   • JUNCTION nucleotide sequences can be entered either directly in the reserved box by typing or by "copy/paste", or by giving the path access to a local file (click on 'Browse' or 'Parcourir' or type its full path in the reserved box).
   • The required format is the FASTA format. Each JUNCTION nucleotide sequences must be preceded by the following information:
     • identifier ("input"), with a 10 character maximum length. This identifier can be a sequence name, an accession number, a clone name, etc.
       Note that the identifier must be unique in a given set of JUNCTION.
     • the name of the V-GENE and ALLELE according to the IMGT gene name nomenclature.
     • the name of the J-GENE and ALLELE according to the IMGT gene name nomenclature.

   • There is no limitation in the number of sequences to be analysed in a single search. Sequences only need to be entered in the same format, starting a new line for each sequence:

     >Input1, V-GENE and ALLELE name, J-GENE and ALLELE name
     nucleotide sequence (in uppercase or lowercase)
     >Input2, V-GENE and ALLELE name, J-GENE and ALLELE name
     nucleotide sequence (in uppercase or lowercase)
     

     For instance,

     >M62724, IGHV7-4-1*02, IGHJ4*02
     tgtgcgagagaagatagcaatggctacaaaatatttgactactgg
     >Z47269, IGHV1-69*06, IGHJ5*02
     tgtgcgagagggggggctaaggtcgaatttttggagtggtttcatgggtactggttcgacccctgg
     

   • If the V-GENE ALLELE or J-GENE ALLELE is unknown, the JunctionAnalysis tool accepts a '?' character instead of the allele number (ex: IGHV1-2*?) and will run the search against the allele *01 by default.
   • If there are several proposed V-GENEs and/or J-GENEs, the different V-GENE and ALLELE names and/or J-GENE and ALLELE names have to be separated by the '/' character (ex: IGHV1-2*01/IGHV1-3*?/IGHV1-18*02, IGHJ1*01/IGHJ2*01). The IMGT/JunctionAnalysis tool will run the search against the first V-GENE and ALLELE and J-GENE and ALLELE listed.

   Note that:

   • JUNCTION nucleotide sequences must start with the V-REGION 2nd-CYS codon and end with J-REGION J-PHE or J-TRP codon (positions 104 and 118, respectively, in the IMGT unique numbering for V-DOMAIN [5]).
   • "V-GENE and ALLELE" and "J-GENE and ALLELE" are those obtained by querying IMGT/V-QUEST [6]. If several alleles give the same score, select the most probable one.

3. Example of IMGT/JunctionAnalysis results

   The selection of the option 'Example of IMGT/JunctionAnalysis results' allows you to vizualize an example of the results provided by IMGT/JunctionAnalysis.

   Sequences used in the 'Example of IMGT/JunctionAnalysis results':

   >Z70256,IGHV2-26*01,IGHJ4*02
   tgtgtacgtgttgtgcagcgcctggtacccaaatatcactttgaccactgg
   >Z70257,IGHV3-7*02,IGHJ2*01
   tgtgcgagggatggcagctcttatgcccgcccctactggtacttcgatctctgg
   >Z70606,IGHV4-31*03,IGHJ3*01
   tgtgcgagagcgactacgcactatgcttttgatgtctgg
   >Z70608,IGHV4-39*05,IGHJ3*02
   tgtgccagagtaacgatttttggagtggttattccccgggggaatgcttttgatatctgg
   >Z70610,IGHV4-34*09,IGHJ3*02
   tgtgcgagagtcgggagcgatttttggagtggttattcccgacatgatgcttttgatatctgg
   >Z70611,IGHV4-59*01,IGHJ5*02
   tgtgcgagacatggtaactataatgccggcgttgactggttcgacccctgg
   >Z70613,IGHV4-59*01,IGHJ4*02
   tgtgcgagagcagcagctggtacctccctctttgactactgg
   >Z70614,IGHV4-59*01,IGHJ4*02
   tgtgcgagacactataattcggggacttatcccctcgactactgg
   >Z70615,IGHV4-59*01,IGHJ2*01
   tgtgcgagagggctggtaaagagggtttcggaatactggtacttcgatctctgg
   >Z70616,IGHV4-34*01,IGHJ5*02
   tgtgcgagagcgggtttgggttcccactggttcgacccctgg
   >Z70620,IGHV4-30-4*01,IGHJ3*02
   tgtgcgagagaccggggcgggatggttcgggatgcttttgatatctgg
   >Z70621,IGHV4-39*01,IGHJ4*02
   tgtgcgagacaccacgatttatggttcggggagtttgacccccttgactactgg
   >Z70622,IGHV4-39*06,IGHJ4*03
   tgtgcgagagattgccccgctcctgccaaaatgtattactatggttcggggatatgtacgtttgactactgg
   

4. Display Results
   • "List of all eligible D-GENE."
     This option allows one to visualize all D genes that match a junction and to compare their score. It is displayed by default when only one junction is analyzed in the run, but can be disable.

   • "Colored IMGT AA classes and histogram."
     The IMGT AA classes and histogram are displayed by default with colors of the AA according to the 11 IMGT physicochemical AA classes (Pommié et al. 2004) (IMGT Aide-mémoire>Amino acids, http://www.imgt.org) , but can be disable.

   • "Output order" in "CDR3-IMGT length decreasing order" or in "CDR3-IMGT length increasing order."
     The results in "JUNCTION alignments with translation and IMGT AA classes" may be displayed in "Same order as input" (default), in "CDR3-IMGT length decreasing order," or "CDR3-IMGT length increasing order".

5. Advanced Parameters
   • 5' and 3' ends of the JUNCTION:
     • Default: the JUNCTION nucleotide sequences must start in 5' with a cystein (tgt or tgc) codon and must end in 3' with a tryptophan (tgg) or phenylalanine (ttt or ttc) codon.
     • The JUNCTION nucleotide sequences may start in 5' and/or may end in 3' with any codon.

   • Nb of D-GENEs (for IGH, TRB and TRD JUNCTION):
     • Default values are 1 for IGH, 1 for TRB and 3 for TRD.
     • You may modify it from 0 to 3.

   • Number of accepted mutations in 3'V-REGION, D-REGION, and 5'J-REGION:
     • - Default values are:

       	3'V-REGION and 5'J-REGION	D-REGION
       IGH	2	4
       IGK	7	NR
       IGL	7	NR
       TRA	0	NR
       TRB	0	0
       TRD	0	0
       TRG	0	NR

       NR= non relevant

       You can modify these numbers from 0 to 10 in the corresponding 3'V-REGION, D-REGION, and 5'J-REGION drop-down lists.

   • Delimitation of 3'V-REGION, D-REGION and 5'J-REGION:
     • Default: the patterns 'm', 'm-' and 'mm--' are trimmed from the 3'V-REGION and 3' end of the D-REGION,
       the patterns 'm', '-m' and '--mm' are trimmed from the 5'J-REGION and 5' end of the D-REGION where 'm' indicates a mutation and '-' indicates an identical nucleotide by comparison with the corresponding alleles germline sequences.

     • Stop trimming with the first encountered identical nucleotide

   • D-GENE choice (if several have the same score):
     • The less mutated one,
     • The longest one,
     • The one more upstream in the locus.

IMGT/JunctionAnalysis Results

The IMGT/JunctionAnalysis Results comprises:

• A brief summary at the top of the page with:
  • the locus and species name
  • a link, for information, to the Locus representation in the IMGT Repertoire
  • the number of submitted junctions
  • the number of results
  • the number of junctions with no results if any, and a link to display the corresponding list (see the section "List of junctions with no results")
  • the values of the parameters used by the tool for the analysis:
    - Maximum number of accepted mutations
    - Deletion limits
    - Best D-GENE choice for a same score
  

• Analysis of the JUNCTIONs:

  The "Analysis of the JUNCTION" provides the results of the analysis of the junctions at the nucleotide level.
  

  • The junctions are displayed according to the order of the sequence submissions with the names of the input sequences and names of the V and J genes and alleles as provided by the user.
    Note that the gene and allele names are preceded by the short name of the species (encoded on 6 characters, for example Homsap for Homo sapiens or Musmus for Mus musculus).
  • Nucleotides of each region identified in a JUNCTION are displayed.
    Dots in 3'V-REGION, D-REGION and 5'J-REGION indicate nucleotides trimmed in the rearranged sequence, by comparison to the corresponding germline 3'V-REGION, D-REGION and 5'J-REGION.
    Underlined nucleotides represent the mutated nucleotides: you can click on a mutated nucleotide to see the original one in the germline region.
  • N, N1, N2, N3, N4 indicate N-REGIONs. If there are several N-REGIONs, they are numbered from left to right.
  • P indicate P-REGIONs (there is no numbering for the P-REGIONs).

  The information provided in the IMGT/JunctionAnalysis Search page is reported in 3 columns (blue):

  • Input
  • V name: IMGT V-GENE and ALLELE name
  • J name: IMGT J-GENE and ALLELE name

  Results from the IMGT/JunctionAnalysis tool are displayed in the other columns:

  • D name: IMGT D-GENE and ALLELE name for IGH and TRB loci (In the case of the TRD locus the names of the 3 IGHD genes are displayed above their respective sequences)
  • Vmut: Number of mutations in the "input" 3'V-REGION identified by the IMGT/JunctionAnalysis tool, by comparison to the corresponding germline allele sequence.
  • Dmut: Number of mutations in the D-REGION sequence identified by the IMGT/JunctionAnalysis tool, by comparison to the corresponding germline allele sequence.
  • Jmut: Number of mutations in the "input" 5'J-REGION identified by the IMGT/JunctionAnalysis tool, compared to the corresponding germline allele sequence.
  • Ngc: Ratio of the number of g+c nucleotides to the total number of N region nucleotides.

• JUNCTION alignments with translation and IMGT AA classes:
  
  • Each JUNCTION nucleotide sequence is translated in amino acid sequences. In the case of frameshifts, gaps indicated by one or two dots are inserted to maintain the J-REGION reading frame and to facilitate sequence comparison.
  • Codons and amino acids are numbered according to the IMGT unique numbering for V-DOMAIN.
  • The numbering is made according to the longest JUNCTION obtained in the results.
  • Colors of the amino acid classes are according to the eleven IMGT amino acid chemical characteristics classes [7]

  Note that:

  • Gaps inserted in JUNCTIONs may split a D-REGION or a J-REGION since the gaps are localized at the top of the CDR3-IMGT loops and depend on the CDR3-IMGT lengths and not on the sequence alignement.

  • '*' indicates a STOP-CODON,
  • '#' indicates a frameshift,
  • '+' and '-' at the end of the line indicates "in-frame" and "out-of-frame" JUNCTION, respectively.
  • The CDR3-IMGT length, Molecular mass and pI values are indicated as "NR" (not relevant) in case of "out-of-frame" JUNCTION

  The option "Colored IMGT AA classes and histogram" of 'Advanced parameters' allows the display the JUNCTION alignments with translation with or without IMGT AA classes and historgam .

• List of junctions with no results

  The list of junctions with no results is displayed at the bottom of the results page. It comprises the sequence identifiers and related comments.

  
  
  Note that: V gene and allele sequences that are partial in 3' are not included in the IMGT reference directory of IMGT/JunctionAnalysis because the 3' end of the V gene and allele cannot be delimitated correctly in the junctions.

Comparison between IMGT/JunctionAnalysis and IMGT/V-QUEST results

1. The IMGT/JunctionAnalysis is by far a more accurate tool for the D-GENE and ALLELE name identification and delimitation. However, IMGT/V-QUEST has the advantage of proposing several solutions, which can be useful in some cases.
2. The way IMGT/V-QUEST and IMGT/JunctionAnalysis identify the D-GENEs is not identical, therefore the scores can be compared for a given tool, but score differences may be observed between the tools.
3. For two D-GENEs ans ALLELEs with an identical score in the IMGT/V-QUEST results, IMGT/JunctionAnalysis, in the default configuration selects the solution which gives the smallest N regions, or, in other terms, selects a longer D (accepting nucleotide differences) to a shorter D (without nucleotide differences).
4. IMGT/JunctionAnalysis for statistical analysis: see ref [8].

Authors:

The first version of IMGT/JunctionAnalysis tool was developed by Mehdi Yousfi, student in the Licence d'Informatique, Université Montpellier II, during a stay in the Laboratoire d'ImmunoGénétique Moléculaire, IGH, CNRS, Montpellier, France.

IMGT/JunctionAnalysis in its present version has been developed by Denys Chaume, Véronique Giudicelli and Patrice Duroux.

References:

[1]	Yousfi Monod, M. et al., Bioinformatics, 20, I379-I385 (2004) PMID: 15262823
[2]	Lefranc, M.-P., Methods Mol. Biol., 248, 27-49 (2004) PMID: 14970490
[3]	Lefranc, M.-P., Current Protocols in Immunology, pp. A.1W.1-A.1W.15 (2006)
[4]	Giudicelli, V. and Lefranc, M.-P., Nova Science, pp77-105 (2005)
[5]	Lefranc, M.-P. et al., Dev. Comp. Immunol., 27, 55-77 (2003) PMID: 12477501
[6]	Giudicelli, V. et al., Nucl. Acids Res., 32, W435-440 (2004) PMID: 15215425
[7]	Pommié, C. et al., J. Mol. Recognit., 17, 17-32 (2004) PMID:14872534 LIGM:284
[8]	Bleakley K. et al., In Silico Biology. J. Epub 2006,6,0051 LIGM:319

Created: 31/08/2001
Last updated: 29/11/2011

IMGT Home page | IMGT Repertoire (IG and TR), (MHC), (RPI) | IMGT Index | IMGT Scientific chart | IMGT Education

Use of this software should be cited as beeing part of "IMGT, the international ImMunoGeneTics information system® http://www.imgt.org (Initiator and coordinator: Marie-Paule Lefranc, Montpellier, France)" with the references: Lefranc, M.-P. et al., Nucleic Acids Res., 33, D593-D597 (2005) Full text, Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2005); Lefranc, M.-P. et al., Nucleic Acids Research 2009 37(Database issue): D1006-D1012; doi:10.1093/nar/gkn838 Full text.
For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.

     

IMGT initiator and coordinator: Marie-Paule Lefranc (Marie-Paule.Lefranc@igh.cnrs.fr)
Bioinformatics manager: Véronique Giudicelli (Veronique.Giudicelli@igh.cnrs.fr)
Computer manager: Patrice Duroux (Patrice.Duroux@igh.cnrs.fr)
Interface design: Chantal Ginestoux (Chantal.Ginestoux@igh.cnrs.fr)

Citing IMGT | Warranty disclaimer and copyright notice | Privacy policy and advertisement policy

© Copyright 1995-2012 IMGT®, the international ImMunoGeneTics information system®