IMGT/JunctionAnalysis Documentation
http://www.imgt.org

Citing IMGT/JunctionAnalysis:
Yousfi Monod, M. et al., Bioinformatics, 20, i379-i385 (2004). PMID: 15262823.
Giudicelli, V., Lefranc, M.-P., Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.prot5634. doi: 10.1101/pdb.prot5634.
PMID: 21632777 Abstract also in IMGT booklet with generous provision from Cold Spring Harbor (CSH) Protocols (high res) (lower res)

IMGT/JunctionAnalysis programme version
IMGT/JunctionAnalysis reference directory release

Table of contents

Introduction

IMGT/JunctionAnalysis [1], at Montpellier, is an integrated analysis tool for the analysis of Immunoglobulin (IG) and T cell receptor (TR) JUNCTION nucleotide sequences. IMGT/JunctionAnalysis analyses in a single search up to 5000 junctions provided that the IMGT V-GENE and J-GENE and ALLELE names are identified [1-4]. The tool:

IMGT/JunctionAnalysis Welcome page

The IMGT/JunctionAnalysis Welcome page allows to enter the input information.

  1. Selection:
  2. The analysis of IG and TR junctions of mice and humans can be performed exhaustively. Analysis of junctions of other species (rat, rabbit, trout) becomes progressively more available as genomic sequences are annotated in IMGT.

  3. JUNCTION nucleotide sequences:

    Note that:

  4. Example of IMGT/JunctionAnalysis results

    The selection of the option 'Example of IMGT/JunctionAnalysis results' allows you to vizualize an example of the results provided by IMGT/JunctionAnalysis.

    Sequences used in the 'Example of IMGT/JunctionAnalysis results':

    >Z70256,IGHV2-26*01,IGHJ4*02
    tgtgtacgtgttgtgcagcgcctggtacccaaatatcactttgaccactgg
    >Z70257,IGHV3-7*02,IGHJ2*01
    tgtgcgagggatggcagctcttatgcccgcccctactggtacttcgatctctgg
    >Z70606,IGHV4-31*03,IGHJ3*01
    tgtgcgagagcgactacgcactatgcttttgatgtctgg
    >Z70608,IGHV4-39*05,IGHJ3*02
    tgtgccagagtaacgatttttggagtggttattccccgggggaatgcttttgatatctgg
    >Z70610,IGHV4-34*09,IGHJ3*02
    tgtgcgagagtcgggagcgatttttggagtggttattcccgacatgatgcttttgatatctgg
    >Z70611,IGHV4-59*01,IGHJ5*02
    tgtgcgagacatggtaactataatgccggcgttgactggttcgacccctgg
    >Z70613,IGHV4-59*01,IGHJ4*02
    tgtgcgagagcagcagctggtacctccctctttgactactgg
    >Z70614,IGHV4-59*01,IGHJ4*02
    tgtgcgagacactataattcggggacttatcccctcgactactgg
    >Z70615,IGHV4-59*01,IGHJ2*01
    tgtgcgagagggctggtaaagagggtttcggaatactggtacttcgatctctgg
    >Z70616,IGHV4-34*01,IGHJ5*02
    tgtgcgagagcgggtttgggttcccactggttcgacccctgg
    >Z70620,IGHV4-30-4*01,IGHJ3*02
    tgtgcgagagaccggggcgggatggttcgggatgcttttgatatctgg
    >Z70621,IGHV4-39*01,IGHJ4*02
    tgtgcgagacaccacgatttatggttcggggagtttgacccccttgactactgg
    >Z70622,IGHV4-39*06,IGHJ4*03
    tgtgcgagagattgccccgctcctgccaaaatgtattactatggttcggggatatgtacgtttgactactgg
    
  5. Display Results
  6. Advanced Parameters

IMGT/JunctionAnalysis Results

The IMGT/JunctionAnalysis Results comprises:

Comparison between IMGT/JunctionAnalysis and IMGT/V-QUEST results

  1. The IMGT/JunctionAnalysis is by far a more accurate tool for the D-GENE and ALLELE name identification and delimitation. However, IMGT/V-QUEST has the advantage of proposing several solutions, which can be useful in some cases.
  2. The way IMGT/V-QUEST and IMGT/JunctionAnalysis identify the D-GENEs is not identical, therefore the scores can be compared for a given tool, but score differences may be observed between the tools.
  3. For two D-GENEs ans ALLELEs with an identical score in the IMGT/V-QUEST results, IMGT/JunctionAnalysis, in the default configuration selects the solution which gives the smallest N regions, or, in other terms, selects a longer D (accepting nucleotide differences) to a shorter D (without nucleotide differences).
  4. IMGT/JunctionAnalysis for statistical analysis: see ref [8].

Authors:

The first version of IMGT/JunctionAnalysis tool was developed by Mehdi Yousfi, student in the Licence d'Informatique, Université Montpellier II, during a stay in the Laboratoire d'ImmunoGénétique Moléculaire, IGH, CNRS, Montpellier, France.

IMGT/JunctionAnalysis in its present version has been developed by Denys Chaume, Véronique Giudicelli and Patrice Duroux.

References:

[1] Yousfi Monod, M. et al., Bioinformatics, 20, I379-I385 (2004) PMID: 15262823
[2] Lefranc, M.-P., Methods Mol. Biol., 248, 27-49 (2004) PMID: 14970490
[3] Lefranc, M.-P., Current Protocols in Immunology, pp. A.1W.1-A.1W.15 (2006)
[4] Giudicelli, V. and Lefranc, M.-P., Nova Science, pp77-105 (2005)
[5] Lefranc, M.-P. et al., Dev. Comp. Immunol., 27, 55-77 (2003) PMID: 12477501
[6] Giudicelli, V. et al., Nucl. Acids Res., 32, W435-440 (2004) PMID: 15215425
[7] Pommié, C. et al., J. Mol. Recognit., 17, 17-32 (2004) PMID:14872534 LIGM:284
[8] Bleakley K. et al., In Silico Biology. J. Epub 2006,6,0051 LIGM:319