| IMGT/JunctionAnalysis Documentation |
http://www.imgt.org |
|
Citing IMGT/JunctionAnalysis: Yousfi Monod, M. et al., Bioinformatics, 20, i379-i385 (2004). PMID: 15262823. Giudicelli, V., Lefranc, M.-P., Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.prot5634. doi: 10.1101/pdb.prot5634. PMID: 21632777 Abstract also in IMGT booklet with generous provision from Cold Spring Harbor (CSH) Protocols |
The IMGT/JunctionAnalysis Welcome page allows to enter the input information.

Note that the identifier must be unique in a given set of JUNCTION.>Input1, V-GENE and ALLELE name, J-GENE and ALLELE name nucleotide sequence (in uppercase or lowercase) >Input2, V-GENE and ALLELE name, J-GENE and ALLELE name nucleotide sequence (in uppercase or lowercase)
For instance,
>M62724, IGHV7-4-1*02, IGHJ4*02 tgtgcgagagaagatagcaatggctacaaaatatttgactactgg >Z47269, IGHV1-69*06, IGHJ5*02 tgtgcgagagggggggctaaggtcgaatttttggagtggtttcatgggtactggttcgacccctgg
Note that:
The selection of the option 'Example of IMGT/JunctionAnalysis results' allows you to vizualize an example of the results provided by IMGT/JunctionAnalysis.
Sequences used in the 'Example of IMGT/JunctionAnalysis results':
>Z70256,IGHV2-26*01,IGHJ4*02 tgtgtacgtgttgtgcagcgcctggtacccaaatatcactttgaccactgg >Z70257,IGHV3-7*02,IGHJ2*01 tgtgcgagggatggcagctcttatgcccgcccctactggtacttcgatctctgg >Z70606,IGHV4-31*03,IGHJ3*01 tgtgcgagagcgactacgcactatgcttttgatgtctgg >Z70608,IGHV4-39*05,IGHJ3*02 tgtgccagagtaacgatttttggagtggttattccccgggggaatgcttttgatatctgg >Z70610,IGHV4-34*09,IGHJ3*02 tgtgcgagagtcgggagcgatttttggagtggttattcccgacatgatgcttttgatatctgg >Z70611,IGHV4-59*01,IGHJ5*02 tgtgcgagacatggtaactataatgccggcgttgactggttcgacccctgg >Z70613,IGHV4-59*01,IGHJ4*02 tgtgcgagagcagcagctggtacctccctctttgactactgg >Z70614,IGHV4-59*01,IGHJ4*02 tgtgcgagacactataattcggggacttatcccctcgactactgg >Z70615,IGHV4-59*01,IGHJ2*01 tgtgcgagagggctggtaaagagggtttcggaatactggtacttcgatctctgg >Z70616,IGHV4-34*01,IGHJ5*02 tgtgcgagagcgggtttgggttcccactggttcgacccctgg >Z70620,IGHV4-30-4*01,IGHJ3*02 tgtgcgagagaccggggcgggatggttcgggatgcttttgatatctgg >Z70621,IGHV4-39*01,IGHJ4*02 tgtgcgagacaccacgatttatggttcggggagtttgacccccttgactactgg >Z70622,IGHV4-39*06,IGHJ4*03 tgtgcgagagattgccccgctcctgccaaaatgtattactatggttcggggatatgtacgtttgactactgg
| 3'V-REGION and 5'J-REGION | D-REGION | |
| IGH | 2 | 4 |
| IGK | 7 | NR |
| IGL | 7 | NR |
| TRA | 0 | NR |
| TRB | 0 | 0 |
| TRD | 0 | 0 |
| TRG | 0 | NR |
You can modify these numbers from 0 to 10 in the corresponding 3'V-REGION, D-REGION, and 5'J-REGION drop-down lists.
The IMGT/JunctionAnalysis Results comprises:

The "Analysis of the JUNCTION" provides the results of the analysis of the junctions at the nucleotide
level.
Note that the gene and allele names are preceded by the short name of the species
(encoded on 6 characters, for example Homsap for Homo sapiens or Musmus for Mus musculus).
The information provided in the IMGT/JunctionAnalysis Search page is reported in 3 columns (blue):
Results from the IMGT/JunctionAnalysis tool are displayed in the other columns:

Note that:
The option "Colored IMGT AA classes and histogram" of 'Advanced parameters' allows the display the JUNCTION alignments with translation with or without IMGT AA classes and histogram.

Note that: V gene and allele sequences that are partial in 3' are not included
in the IMGT reference directory of IMGT/JunctionAnalysis because the 3' end of the V gene and allele cannot be delimitated correctly in the junctions.
Authors:
The first version of IMGT/JunctionAnalysis tool was developed by Mehdi Yousfi, student in the Licence d'Informatique, Université Montpellier II, during a stay in the Laboratoire d'ImmunoGénétique Moléculaire, IGH, CNRS, Montpellier, France.
IMGT/JunctionAnalysis in its present version has been developed by Denys Chaume, Véronique Giudicelli and Patrice Duroux.
| [1] | Yousfi Monod, M. et al., Bioinformatics, 20, I379-I385 (2004) PMID: 15262823 |
| [2] | Lefranc, M.-P., Methods Mol. Biol., 248, 27-49 (2004) PMID: 14970490 |
| [3] | Lefranc, M.-P., Current Protocols in Immunology, pp. A.1W.1-A.1W.15 (2006) |
| [4] | Giudicelli, V. and Lefranc, M.-P., Nova Science, pp77-105 (2005) |
| [5] | Lefranc, M.-P. et al., Dev. Comp. Immunol., 27, 55-77 (2003)
PMID: 12477501
|
| [6] | Giudicelli, V. et al., Nucl. Acids Res., 32, W435-440 (2004)
PMID: 15215425
|
| [7] | Pommié, C. et al., J. Mol. Recognit., 17, 17-32 (2004) PMID:14872534 LIGM:284 |
| [8] | Bleakley K. et al., In Silico Biology. J. Epub 2006,6,0051 LIGM:319 |