Alignment of alleles: Clearnose skate (Raja eglanteria) IGHD (overview)

Only one sequence for each allele is shown. This set of sequences is part of the IMGT reference directory.
Other known sequences are shown in the individual  Alignments of alleles.

                     Direct 5'- 3' orientation            Inverted orientation
 U08009  ,IGHD1*01
 T  I  W  V                            
  L  Y  G  W 
   Y  M  G      
ACTATATGGGTGG
 P  P  I  *                                                  
  H  P  Y  S                                                  
  T  H  I                                                    
 CCACCCATATAGT
 U08009  ,IGHD2*01
 I  L  A                       
  Y  W         
   T  G       
ATACTGGCC
 G  Q  Y                                                      
  A  S                                                        
   P  V        
GGCCAGTAT
 U08010  ,IGHD3*01 #c
 S  P  Y  M  G  G  D  E    
  P  P  I  W  V  E  T     
   P  L  Y  G  W  R  R   
TCCCCCTATATGGGTGGAGACGAG
 L  V  S  T  H  I  G  G                                       
  S  S  P  P  I  *  G                                         
   R  L  H  P  Y  R  G 
CTCGTCTCCACCCATATAGGGGGA
 U08012  ,IGHD4*01 #c
 T  I  W  V      
  L  Y  G  W     
   Y  M  G       
ACTATATGGGTGG
 P  P  I  *                                                  
  H  P  Y  S                                                  
   T  H  I           
CCACCCATATAGT
 U08012  ,IGHD5*01 #c   
 T  I  L  V  P    
  L  Y  W  Y       
   Y  T  G  T   
ACTATACTGGTACCT
 R  Y  Q  Y  S                                                
  G  T  S  I                                                  
   V  P  V  *       
AGGTACCAGTATAGT
#c: rearranged cDNA


Created: Tuesday, 03-Apr-2012 08:20:19 CEST
Author: Dominique Scaviner
Contact: Marie-Paule Lefranc

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Research, 27, 209-212 (1999) Cover of NAR; Ruiz, M. et al., Nucleic Acids Research, 28, 219-221 (2000); Lefranc, M.-P., Nucleic Acids Research, 29, 207-209 (2001); Lefranc, M.-P., Nucleic Acids Res., 31, 307-310 (2003); Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5, 45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33, D593-D597 (2005) Full text; Lefranc, M.-P. et al., Nucleic Acids Research 2009 37: D1006-D1012; doi:10.1093/nar/gkn838 Full text.


IMGT founder and director: Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr
Bioinformatics manager: Véronique Giudicelli Veronique.Giudicelli@igh.cnrs.fr
Computer manager: Patrice Duroux Patrice.Duroux@igh.cnrs.fr
Webmaster: Chantal Ginestoux Chantal.Ginestoux@igh.cnrs.fr
     

Citing IMGT
Warranty disclaimer and copyright notice
Privacy policy and advertisement policy

© Copyright 1995-2012 IMGT®, the international ImMunoGeneTics information system®