Alignment of alleles: Little skate (Leucoraja erinacea) IGHD (overview)

Only one sequence for each allele is shown. This set of sequences is part of the IMGT reference directory.
Other known sequences are shown in the individual  Alignments of alleles.

                     Direct 5'- 3' orientation         Inverted orientation

X15124  ,IGHD1*01 
 Y  N  S  G
  T  T  V  G
   Q  Q  W
TACAACAGTGGGT
 T  H  C  C
  P  T  V  V
   P  L  L
ACCCACTGTTGTA
X15124  ,IGHD2*01 
 Y  T
  I  L
   Y  W
TATACTGG
 P  V
  Q  Y
   S  I
CCAGTATA
X15125  ,IGHD3*01 ~VD     
 T  D  Q  Q  G  A  D
  Q  I  N  R  G  Q  M
   R  S  T  G  G  R  *
ACAGATCAACAGGGGGCAGATGA     
 S  S  A  P  C  *  S
  H  L  P  P  V  D  L
   I  C  P  L  L  I  C
TCATCTGCCCCCTGTTGATCTGT
X16146  ,IGHD4*01 ~VD,DJ
 H  V  G
  M  W  G
   C  G
CATGTGGGGT
 T  P  H
  P  H  M
   P  T
ACCCCACATG
X16146  ,IGHD5*01 ~VD,DJ
 L  *  Y
  Y  S
   I  V
CTATAGTAC
 V  L  *
  Y  Y
   T  I
GTACTATAG
M29672  ,IGHD6*01 #c
 A  A  M  G  G  S  I  Y
  Q  P  W  G  A  L  Y
   S  H  G  G  L  Y  I
GCAGCCATGGGGGGCTCTATATAC
 V  Y  R  A  P  H  G  C
  Y  I  E  P  P  M  A
   I  *  S  P  P  W  L
GTATATAGAGCCCCCCATGGCTGC
M29679  ,IGHD7*01 #c
 R  G  T  T  M  I
  E  G  Q  Q  *
   R  D  N  N  D
AGAGGGACAACAATGATC
 D  H  C  C  P  S
  I  I  V  V  P
   S  L  L  S  L
GATCATTGTTGTCCCTCT
#c: rearranged cDNA
~VD: VD genomic DNA rearranged in the cassette
~VD,DJ: VD,DJ genomic DNA rearranged in the cassette


Created: Tuesday, 03-Apr-2012 08:20:21 CEST
Author: Dominique Scaviner

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209 Full text Cover; Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219 Full text; Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207 Full text; Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085 Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056 Full text.
For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.

CNRS Université de Montpellier European Commission
IMGT® Founder and Executive Director Emeritus:
Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr
IMGT® Director:
Sofia Kossida Sofia.Kossida@igh.cnrs.fr
Bioinformatics manager:
Véronique Giudicelli Veronique.Giudicelli@igh.cnrs.fr
Computer manager:
Patrice Duroux Patrice.Duroux@igh.cnrs.fr
Webmaster:
Amélie Houles

Citing IMGT | Warranty disclaimer and copyright notice | Privacy policy and advertisement policy

© Copyright 1995-2017 IMGT®, the international ImMunoGeneTics information system®