Alignment of alleles: Little skate (Raja erinacea) IGHD (overview)

Only one sequence for each allele is shown. This set of sequences is part of the IMGT reference directory.
Other known sequences are shown in the individual  Alignments of alleles. 

                     Direct 5'- 3' orientation         Inverted orientation

X15124  ,IGHD1*01 
 
 Y  N  S  G
  T  T  V  G
   Q  Q  W
TACAACAGTGGGT
 
 T  H  C  C
  P  T  V  V
   P  L  L
ACCCACTGTTGTA
 
X15124  ,IGHD2*01 
 
 Y  T
  I  L
   Y  W
TATACTGG
 
 P  V
  Q  Y
   S  I
CCAGTATA
 
X15125  ,IGHD3*01 ~VD     
 T  D  Q  Q  G  A  D
  Q  I  N  R  G  Q  M
   R  S  T  G  G  R  *
ACAGATCAACAGGGGGCAGATGA     
 S  S  A  P  C  *  S
  H  L  P  P  V  D  L
   I  C  P  L  L  I  C
TCATCTGCCCCCTGTTGATCTGT
 
X16146  ,IGHD4*01 ~VD,DJ
 
 H  V  G
  M  W  G
   C  G
CATGTGGGGT
 
 T  P  H
  P  H  M
   P  T
ACCCCACATG
 
X16146  ,IGHD5*01 ~VD,DJ
 
 L  *  Y
  Y  S
   I  V
CTATAGTAC
 
 V  L  *
  Y  Y
   T  I
GTACTATAG
 
M29672  ,IGHD6*01 #c
 
 A  A  M  G  G  S  I  Y
  Q  P  W  G  A  L  Y
   S  H  G  G  L  Y  I
GCAGCCATGGGGGGCTCTATATAC
 
 V  Y  R  A  P  H  G  C
  Y  I  E  P  P  M  A
   I  *  S  P  P  W  L
GTATATAGAGCCCCCCATGGCTGC
 
M29679  ,IGHD7*01 #c
 
 R  G  T  T  M  I
  E  G  Q  Q  *
   R  D  N  N  D
AGAGGGACAACAATGATC
 
 D  H  C  C  P  S
  I  I  V  V  P
   S  L  L  S  L
GATCATTGTTGTCCCTCT
#c: rearranged cDNA
~VD: VD genomic DNA rearranged in the cassette
~VD,DJ: VD,DJ genomic DNA rearranged in the cassette

Created: Tuesday, 03-Apr-2012 08:20:21 CEST
Author: Dominique Scaviner
Contact: Marie-Paule Lefranc

IMGT Home page | IMGT Repertoire (IG and TR) | IMGT Repertoire (MH) | IMGT Repertoire (RPI) | IMGT Index | IMGT Scientific chart | IMGT Education

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Research, 27, 209-212 (1999) Cover of NAR; Ruiz, M. et al., Nucleic Acids Research, 28, 219-221 (2000); Lefranc, M.-P., Nucleic Acids Research, 29, 207-209 (2001); Lefranc, M.-P., Nucleic Acids Res., 31, 307-310 (2003); Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5, 45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33, D593-D597 (2005) Full text; Lefranc, M.-P. et al., Nucleic Acids Research 2009 37: D1006-D1012; doi:10.1093/nar/gkn838 Full text.

IMGT founder and director: Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr
Bioinformatics manager: Véronique Giudicelli Veronique.Giudicelli@igh.cnrs.fr
Computer manager: Patrice Duroux Patrice.Duroux@igh.cnrs.fr
Webmaster: Chantal Ginestoux Chantal.Ginestoux@igh.cnrs.fr 		     

Citing IMGT
Warranty disclaimer and copyright notice
Privacy policy and advertisement policy

© Copyright 1995-2012 IMGT®, the international ImMunoGeneTics information system®