For translation of the 3 reading frames in direct and inverted orientations see
the overview.
U18717 ,IGHD17*01 GGGGTGTGGGCCGGGGCTTACTGTGGCGAGGTCTGTAAGCTCACGGGC #c#c: rearranged cDNA
Created: 03/04/2012
Author: Dominique Scaviner
Software material and data coming from IMGT server may be used for academic research only,
provided that it is referred to IMGT®, and cited as
"IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org
(founder and director: Marie-Paule Lefranc, Montpellier, France)."
References to cite:
Lefranc, M.-P. et al.,
Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209
Full text
Cover;
Ruiz, M. et al.,
Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219
Full text;
Lefranc, M.-P.,
Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207
Full text;
Lefranc, M.-P.,
Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085
Full text;
Lefranc, M.-P. et al.,
In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005);
Lefranc, M.-P. et al.,
Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065
Full text;
Lefranc, M.-P. et al.,
Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838
Full text;
Lefranc, M.-P. et al.,
Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056
Full text.
For any other use please contact Marie-Paule Lefranc
Marie-Paule.Lefranc@igh.cnrs.fr.
Citing IMGT | Warranty disclaimer and copyright notice | Privacy policy and advertisement policy
© Copyright 1995-2018 IMGT®, the international ImMunoGeneTics information system®