Alignment of alleles: Nurse shark (Ginglymostoma cirratum) IGHD (overview)

Only one sequence for each allele is shown. This set of sequences is part of the IMGT reference directory.
Other known sequences are shown in the individual  Alignments of alleles.

                                    Direct 5'- 3' orientation                                             Inverted orientation
L38965  ,IGHD1*01          
 I  T  G  I   
  *  L  G  L  
   N  W  D  * 
ATAACTGGGATTGA 
 S  I  P  V   
  Q  S  Q  L  
   N  P  S  Y 
TCAATCCCAGTTAT
L38965  ,IGHD2*01
 L  L  *  I  
  Y  C  E  Y 
   T  V  N 
TTACTGTGAATAC           
 V  F  T  V  
  Y  S  Q  * 
   I  H  S 
GTATTCACAGTAA
L38965  ,IGHD3*01 
 *  Y  A  V   
  D  M  L  S  
   I  C  C  R 
TGATATGCTGTCGA
 S  T  A  Y   
  R  Q  H  I  
   D  S  I  S 
TCGACAGCATATCA
L38966  ,IGHD4*01
 I  T  L  L  W  I  
  *  L  Y  C  G  * 
   N  F  T  V  D  
ATAACTTTACTGTGGATAG
 L  S  T  V  K  L  
  Y  P  Q  *  S  Y 
   I  H  S  K  V 
CTATCCACAGTAAAGTTAT 
L38966  ,IGHD5*01
 C  *  A  G   
  A  E  L  E  
   L  S  W  R 
TGCTGAGCTGGAGA 
 S  P  A  Q   
  L  Q  L  S  
   S  S  S  A 
TCTCCAGCTCAGCA 
L38967  ,IGHD6*01
 I  T  G  I   
  *  L  G  L  
   N  W  D  * 
ATAACTGGGATTGA
 S  I  P  V   
  Q  S  Q  L  
   N  P  S  Y 
TCAATCCCAGTTAT 
L38967  ,IGHD7*01
 L  L  *  I  
  Y  C  E  Y 
   T  V  N 
TTACTGTGAATAC 
 V  F  T  V  
  Y  S  Q  * 
   I  H  S 
GTATTCACAGTAA
L38967  ,IGHD8*01
 *  Y  A  V   
  D  M  L  S  
   I  C  C  R 
TGATATGCTGTCGA
 S  T  A  Y   
  R  Q  H  I  
   D  S  I  S 
TCGACAGCATATCA 
L38968  ,IGHD9*01
 I  A  G  V   
  *  L  V  W  
   S  W  C  G 
ATAGCTGGTGTGGA
 S  T  P  A   
  P  H  Q  L  
   H  T  S  Y 
TCCACACCAGCTAT
L38968  ,IGHD10*01 
 *  L  *  L  
  S  C  D  Y 
   A  V  T 
TAGCTGTGACTAC
 V  V  T  A  
  *  S  Q  L 
   S  H  S 
GTAGTCACAGCTA
L38968  ,IGHD11*01
 C  C  A  L   
  A  V  L  L  
   L  C  S  *  
TGCTGTGCTCTTGA
 S  R  A  Q   
  Q  E  H  S  
   K  S  T  A 
TCAAGAGCACAGCA
M92851  ,IGHD12*01 #c
 R  M  S  G  Y  E  Y  L  G  G  H  S 
  A  *  V  G  M  N  T  W  A  A  T  
   H  E  W  V  *  I  L  G  R  P  L 
CGCATGAGTGGGTATGAATACTTGGGCGGCCACTCC
 G  V  A  A  Q  V  F  I  P  T  H  A 
  E  W  P  P  K  Y  S  Y  P  L  M  
   S  G  R  P  S  I  H  T  H  S  C 
GGAGTGGCCGCCCAAGTATTCATACCCACTCATGCG
AF327520,IGHD13*01 #c
 G  S  T  G  W 
  D  R  L  G  
   I  D  W  V 
GGATCGACTGGGTGG
P  P  S  R  S 
 H  P  V  D  
  T  Q  S  I 
CCACCCAGTCGATCC
U18701  ,IGHD14*01 #c
 W  E  A  A  D  M  C  M  Y  G  V  C  T  I  Y  P  F  S  G 
  G  K  L  L  I  C  V  C  T  G  S  A  L  F  I  P  S  L  
   G  S  C  *  Y  V  Y  V  R  G  L  H  Y  L  S  L  L  W 
TGGGAAGCTGCTGATATGTGTATGTACGGGGTCTGCACTATTTATCCCTTCTCTGGT 
 T  R  E  G  I  N  S  A  D  P  V  H  T  H  I  S  S  F  P 
  P  E  K  G  *  I  V  Q  T  P  Y  I  H  I  S  A  A  S  
   Q  R  R  D  K  *  C  R  P  R  T  Y  T  Y  Q  Q  L  P 
ACCAGAGAAGGGATAAATAGTGCAGACCCCGTACATACACATATCAGCAGCTTCCCA 
U18680  ,IGHD15*01 #c
 Y  R  K  N  W  A  Y  D  C  G  L  E  E  L  D  W  I  Y  V 
  I  G  K  T  G  L  M  T  A  D  S  K  N  S  T  G  F  M  
   *  E  K  L  G  L  *  L  R  T  R  R  T  R  L  D  L  C 
TATAGGAAAAACTGGGCTTATGACTGCGGACTCGAAGAACTCGACTGGATTTATGTA
 Y  I  N  P  V  E  F  F  E  S  A  V  I  S  P  V  F  P  I 
  T  *  I  Q  S  S  S  S  S  P  Q  S  *  A  Q  F  F  L  
   H  K  S  S  R  V  L  R  V  R  S  H  K  P  S  F  S  Y 
TACATAAATCCAGTCGAGTTCTTCGAGTCCGCAGTCATAAGCCCAGTTTTTCCTATA
U18716  ,IGHD16*01 #c
 R  G  S  G  Y  G  C  F  K  Y  E  V 
  G  V  L  V  M  G  A  S  N  M  K  
   G  F  W  L  W  V  L  Q  I  *  S 
CGGGGTTCTGGTTATGGGTGCTTCAAATATGAAGTA
 Y  F  I  F  E  A  P  I  T  R  T  P 
  T  S  Y  L  K  H  P  *  P  E  P 
   L  H  I  *  S  T  H  N  Q  N  P 
TACTTCATATTTGAAGCACCCATAACCAGAACCCCG 
U18717  ,IGHD17*01 #c
 G  V  W  A  G  A  Y  C  G  E  V  C  K  L  T  G 
  G  C  G  P  G  L  T  V  A  R  S  V  S  S  R  
   G  V  G  R  G  L  L  W  R  G  L  *  A  H  G 
GGGGTGTGGGCCGGGGCTTACTGTGGCGAGGTCTGTAAGCTCACGGGC
 A  R  E  L  T  D  L  A  T  V  S  P  G  P  H  P 
  P  V  S  L  Q  T  S  P  Q  *  A  P  A  H  T  
   P  *  A  Y  R  P  R  H  S  K  P  R  P  T  P 
GCCCGTGAGCTTACAGACCTCGCCACAGTAAGCCCCGGCCCACACCCC 
U18686  ,IGHD18*01 #c
 S  T  W  Y  T  D  I  E  G  G  E  L  G  T  P  C  N  R  Q  H  D  V
  R  P  G  I  P  I  L  K  E  G  N  W  V  P  L  V  I  A  S  M  M 
   D  L  V  Y  R  Y  *  R  R  G  T  G  Y  P  L  *  S  P  A  *  C 
TCGACCTGGTATACCGATATTGAAGGAGGGGAACTGGGTACCCCTTGTAATCGCCAGCATGATGTT 
 N  I  M  L  A  I  T  R  G  T  Q  F  P  S  F  N  I  G  I  P  G  R
  T  S  C  W  R  L  Q  G  V  P  S  S  P  P  S  I  S  V  Y  Q  V
   H  H  A  G  D  Y  K  G  Y  P  V  P  L  L  Q  Y  R  Y  T  R  S 
AACATCATGCTGGCGATTACAAGGGGTACCCAGTTCCCCTCCTTCAATATCGGTATACCAGGTCGA
U18687  ,IGHD19*01 #c
 S  L  Y  N  W  C  S  C  E  T  D  V  L  P 
  P  Y  I  T  G  V  A  V  K  Q  M  C  S  
   L  I  *  L  V  *  L  *  N  R  C  A  P 
TCCTTATATAACTGGTGTAGCTGTGAAACAGATGTGCTCCCC 
 G  E  H  I  C  F  T  A  T  P  V  I  *  G 
  G  S  T  S  V  S  Q  L  H  Q  L  Y  K  
   G  A  H  L  F  H  S  Y  T  S  Y  I  R 
GGGGAGCACATCTGTTTCACAGCTACACCAGTTATATAAGGA 
U18714  ,IGHD20*01 #c
 P  W  D  Y  D  C  N  Y  D  V 
  H  G  T  M  T  A  T  T  M  
   M  G  L  *  L  Q  L  R  C 
CCATGGGACTATGACTGCAACTACGATGTT
 N  I  V  V  A  V  I  V  P  W 
  T  S  *  L  Q  S  *  S  H  
   H  R  S  C  S  H  S  P  M 
AACATCGTAGTTGCAGTCATAGTCCCATGG 
U18718  ,IGHD21*01 #c
 I  S  Y  C  D  D  V  V  C  A  A  N  Y  V 
  Y  P  T  V  T  M  W  S  V  L  L  T  M  
   I  L  L  *  R  C  G  L  C  C  *  L  C 
ATATCCTACTGTGACGATGTGGTCTGTGCTGCTAACTATGTT
 N  I  V  S  S  T  D  H  I  V  T  V  G  Y 
  T  *  L  A  A  Q  T  T  S  S  Q  *  D  
   H  S  *  Q  H  R  P  H  R  H  S  R  I 
AACATAGTTAGCAGCACAGACCACATCGTCACAGTAGGATAT 
U18713  ,IGHD22*01 #c
 A  W  Y  G  T  G  C  V  I  W  G  R  F  L  Y  D  V 
  P  G  M  G  L  A  A  L  S  G  G  V  S  C  M  M  
   L  V  W  D  W  L  R  Y  L  G  A  F  L  V  *  C 
GCCTGGTATGGGACTGGCTGCGTTATCTGGGGGCGTTTCTTGTATGATGTT
 N  I  I  Q  E  T  P  P  D  N  A  A  S  P  I  P  G 
  T  S  Y  K  K  R  P  Q  I  T  Q  P  V  P  Y  Q  
   H  H  T  R  N  A  P  R  *  R  S  Q  S  H  T  R 
AACATCATACAAGAAACGCCCCCAGATAACGCAGCCAGTCCCATACCAGGC 
U18700  ,IGHD23*01 #c
 C  N  A  W  C  G  G  D  K  G  Q  C  D  Y  R  L  L  C  S 
  A  M  P  G  V  G  G  T  R  D  S  V  T  I  A  C  C  V  
   Q  C  L  V  W  G  G  Q  G  T  V  *  L  S  P  A  V  F 
TGCAATGCCTGGTGTGGGGGGGACAAGGGACAGTGTGACTATCGCCTGCTGTGTTCT 
 R  T  Q  Q  A  I  V  T  L  S  L  V  P  P  T  P  G  I  A 
  E  H  S  R  R  *  S  H  C  P  L  S  P  P  H  Q  A  L  
   N  T  A  G  D  S  H  T  V  P  C  P  P  H  T  R  H  C 
AGAACACAGCAGGCGATAGTCACACTGTCCCTTGTCCCCCCCACACCAGGCATTGCA 
U18702  ,IGHD24*01 #c
 G  Q  Y  R  G  C  P  Y  F  L  C  S  H  L  S  Y  A  G 
  D  N  I  G  D  V  P  T  F  C  A  L  T  Y  P  M  L  
   T  I  S  G  M  S  L  L  S  V  L  S  P  I  L  C  W 
GGACAATATCGGGGATGTCCCTACTTTCTGTGCTCTCACCTATCCTATGCTGGA   
 S  S  I  G  *  V  R  A  Q  K  V  G  T  S  P  I  L  S 
  P  A  *  D  R  *  E  H  R  K  *  G  H  P  R  Y  C  
   Q  H  R  I  G  E  S  T  E  S  R  D  I  P  D  I  V 
TCCAGCATAGGATAGGTGAGAGCACAGAAAGTAGGGACATCCCCGATATTGTCC
U18715  ,IGHD25*01 #c
 W  Q  W  G  T  C  D  D  R  I  C  V  H  N  S  R  D 
  G  S  G  G  P  V  T  T  G  S  V  F  T  T  H  V  
   A  V  G  D  L  *  R  P  D  L  C  S  Q  L  T  * 
TGGCAGTGGGGGACCTGTGACGACCGGATCTGTGTTCACAACTCACGTGAC
 V  T  *  V  V  N  T  D  P  V  V  T  G  P  P  L  P 
  S  R  E  L  *  T  Q  I  R  S  S  Q  V  P  H  C  
   H  V  S  C  E  H  R  S  G  R  H  R  S  P  T  A 
GTCACGTGAGTTGTGAACACAGATCCGGTCGTCACAGGTCCCCCACTGCCA
U18726  ,IGHD26*01 #c
 L  R  C  A  S  W  Y  L  D  D  V 
  *  D  A  H  L  G  I  W  M  M  
   E  M  R  I  L  V  S  G  *  C 
CTGAGATGCGCATCTTGGTATCTGGATGATGTA  
 Y  I  I  Q  I  P  R  C  A  S  Q 
  T  S  S  R  Y  Q  D  A  H  L  
   H  H  P  D  T  K  M  R  I  S 
TACATCATCCAGATACCAAGATGCGCATCTCAG
U18693  ,IGHD27*01 #c
 W  P  S  W  S  G  H  G  C  E  S  D  W  A  V  G  G  A 
  G  L  P  G  R  A  M  G  V  K  V  T  G  L  L  G  G  
   A  F  L  V  G  P  W  V  *  K  *  L  G  C  W  G  G 
TGGCCTTCCTGGTCGGGCCATGGGTGTGAAAGTGACTGGGCTGTTGGGGGGGCC
 G  P  P  N  S  P  V  T  F  T  P  M  A  R  P  G  R  P 
  A  P  P  T  A  Q  S  L  S  H  P  W  P  D  Q  E  G  
   P  P  Q  Q  P  S  H  F  H  T  H  G  P  T  R  K  A 
GGCCCCCCCAACAGCCCAGTCACTTTCACACCCATGGCCCGACCAGGAAGGCCA
U18725  ,IGHD28*01 #c
 A  G  T  H  S  G  C  A  L  C  S  F  I  Q  I  E  A  T 
  P  V  H  I  R  D  V  R  C  V  L  S  S  K  L  R  L  
   R  Y  T  F  G  M  C  A  V  F  F  H  P  N  *  G  Y 
GCCGGTACACATTCGGGATGTGCGCTGTGTTCTTTCATCCAAATTGAGGCTACC
 G  S  L  N  L  D  E  R  T  Q  R  T  S  R  M  C  T  G 
  V  A  S  I  W  M  K  E  H  S  A  H  P  E  C  V  P  
   *  P  Q  F  G  *  K  N  T  A  H  I  P  N  V  Y  R 
GGTAGCCTCAATTTGGATGAAAGAACACAGCGCACATCCCGAATGTGTACCGGC
U18685  ,IGHD29*01 #c
 S  V  G  V  I  Y  A  R  C  P  P  C  D  R  Q 
  Q  L  V  S  Y  M  R  A  V  R  P  V  I  A  
   S  W  C  H  I  C  A  L  S  A  L  *  S  P 
TCAGTTGGTGTCATATATGCGCGCTGTCCGCCCTGTGATCGCCAA
 L  A  I  T  G  R  T  A  R  I  Y  D  T  N  * 
  W  R  S  Q  G  G  Q  R  A  Y  M  T  P  T  
   G  D  H  R  A  D  S  A  H  I  *  H  Q  L 
TTGGCGATCACAGGGCGGACAGCGCGCATATATGACACCAACTGA
U18688  ,IGHD30*01 #c
 G  M  L  H  D  C  D  W  S  D  Y  D  V 
  V  C  C  M  T  A  T  G  R  T  M  M  
   Y  A  A  *  L  R  L  V  G  L  *  C 
GGTATGCTGCATGACTGCGACTGGTCGGACTATGATGTA
 Y  I  I  V  R  P  V  A  V  M  Q  H  T 
  T  S  *  S  D  Q  S  Q  S  C  S  I  
   H  H  S  P  T  S  R  S  H  A  A  Y 
TACATCATAGTCCGACCAGTCGCAGTCATGCAGCATACC
U18724  ,IGHD31*01 #c
 A  L  D  R  G  Y  S  C  D  C  S  A  R  Q  A  R 
  L  W  T  G  A  I  V  V  T  A  L  P  V  R  L  
   F  G  P  G  L  *  L  *  L  L  C  P  S  G  S 
GCTTTGGACCGGGGCTATAGTTGTGACTGCTCTGCCCGTCAGGCTCGA
 S  S  L  T  G  R  A  V  T  T  I  A  P  V  Q  S 
  R  A  *  R  A  E  Q  S  Q  L  *  P  R  S  K  
   E  P  D  G  Q  S  S  H  N  Y  S  P  G  P  K 
TCGAGCCTGACGGGCAGAGCAGTCACAACTATAGCCCCGGTCCAAAGC
U18696  ,IGHD32*01 #c
 N  T  Y  A  C  A  F  S  C  S  W  D 
  I  P  M  L  V  R  F  L  A  L  G  
   Y  L  C  L  C  V  F  L  L  L  G 
AATACCTATGCTTGTGCGTTTTCTTGCTCTTGGGAC
 V  P  R  A  R  K  R  T  S  I  G  I 
  S  Q  E  Q  E  N  A  Q  A  *  V  
   P  K  S  K  K  T  H  K  H  R  Y 
GTCCCAAGAGCAAGAAAACGCACAAGCATAGGTATT
U18705  ,IGHD33*01 #c
 C  V  S  S  R  C  S  D  D  C  D  H  G  K  S  C  N  L  G 
  A  F  Q  V  G  V  V  M  T  V  T  T  G  S  P  V  T  L  
   R  F  K  *  V  *  *  *  L  *  P  R  E  V  L  *  P  W 
TGCGTTTCAAGTAGGTGTAGTGATGACTGTGACCACGGGAAGTCCTGTAACCTTGGC
 A  K  V  T  G  L  P  V  V  T  V  I  T  T  P  T  *  N  A 
  P  R  L  Q  D  F  P  W  S  Q  S  S  L  H  L  L  E  T  
   Q  G  Y  R  T  S  R  G  H  S  H  H  Y  T  Y  L  K  R 
GCCAAGGTTACAGGACTTCCCGTGGTCACAGTCATCACTACACCTACTTGAAACGCA
U18703  ,IGHD34*01 #c
 C  G  E  C  S  W  C  G  G  S  C  D  W  L  L  L  S  G  G  N  G
  A  G  N  A  A  G  V  V  V  A  V  T  G  F  C  S  R  G  G  M
   R  G  M  Q  L  V  W  W  *  L  *  L  A  S  A  L  G  G  E  W 
TGCGGGGAATGCAGCTGGTGTGGTGGTAGCTGTGACTGGCTTCTGCTCTCGGGGGGGAATGGT
 T  I  P  P  R  E  Q  K  P  V  T  A  T  T  T  P  A  A  F  P  A
  P  F  P  P  E  S  R  S  Q  S  Q  L  P  P  H  Q  L  H  S  P
   H  S  P  P  R  A  E  A  S  H  S  Y  H  H  T  S  C  I  P  R
ACCATTCCCCCCCGAGAGCAGAAGCCAGTCACAGCTACCACCACACCAGCTGCATTCCCCGCA
U18682  ,IGHD35*01 #c
 D  C  S  I  L  G  T  T  A  L  C  N  R  Y  S  E 
  T  V  R  S  S  G  L  P  P  C  V  I  D  I  V  
   L  F  D  P  R  D  Y  R  P  V  *  S  I  *  * 
GACTGTTCGATCCTCGGGACTACCGCCCTGTGTAATCGATATAGTGAA
 F  T  I  S  I  T  Q  G  G  S  P  E  D  R  T  V 
  S  L  Y  R  L  H  R  A  V  V  P  R  I  E  Q  
   H  Y  I  D  Y  T  G  R  *  S  R  G  S  N  S 
TTCACTATATCGATTACACAGGGCGGTAGTCCCGAGGATCGAACAGTC
U18706  ,IGHD36*01 #c
 N  C  A  G  T  P  V  T  I  I  C  N  P  V 
  T  A  L  V  H  L  *  L  L  S  V  T  L  
   L  R  W  Y  T  C  D  Y  Y  L  *  P  C 
AACTGCGCTGGTACACCTGTGACTATTATCTGTAACCCTGTC
 D  R  V  T  D  N  S  H  R  C  T  S  A  V 
  T  G  L  Q  I  I  V  T  G  V  P  A  Q  
   Q  G  Y  R  *  *  S  Q  V  Y  Q  R  S 
GACAGGGTTACAGATAATAGTCACAGGTGTACCAGCGCAGTT
U18704  ,IGHD37*01 #c
 W  A  Y  S  F  C  P  V  T  T  F  C  A  L  D  E  N  Y  D 
  G  R  I  V  S  V  L  *  L  P  S  V  L  S  M  R  T  M  
   G  V  *  F  L  S  C  D  Y  L  L  C  S  R  *  E  L  * 
TGGGCGTATAGTTTCTGTCCTGTGACTACCTTCTGTGCTCTCGATGAGAACTATGAT
 I  I  V  L  I  E  S  T  E  G  S  H  R  T  E  T  I  R  P 
  S  *  F  S  S  R  A  Q  K  V  V  T  G  Q  K  L  Y  A  
   H  S  S  H  R  E  H  R  R  *  S  Q  D  R  N  Y  T  P 
ATCATAGTTCTCATCGAGAGCACAGAAGGTAGTCACAGGACAGAAACTATACGCCCA
U18681  ,IGHD38*01 #c
 G  Y  V  C  D  F  A  G  S  C  H  G  G  D  E 
  V  M  S  V  T  S  R  A  L  V  T  A  V  T  
   L  C  L  *  L  R  G  L  L  S  R  R  *  R 
GGTTATGTCTGTGACTTCGCGGGCTCTTGTCACGGCGGTGACGAA
 F  V  T  A  V  T  R  A  R  E  V  T  D  I  T 
  S  S  P  P  *  Q  E  P  A  K  S  Q  T  *  
   R  H  R  R  D  K  S  P  R  S  H  R  H  N 
TTCGTCACCGCCGTGACAAGAGCCCGCGAAGTCACAGACATAACC
U18684  ,IGHD39*01 #c
 G  Q  *  L  *  L  R  P  V  L  F  G  V  H  
  G  N  S  C  D  Y  D  L  C  S  L  G  Y  T 
   A  I  A  V  T  T  T  C  A  L  W  G  T 
GGGCAATAGCTGTGACTACGACCTGTGCTCTTTGGGGTACACT
 S  V  P  Q  R  A  Q  V  V  V  T  A  I  A  
  V  Y  P  K  E  H  R  S  *  S  Q  L  L  P 
   C  T  P  K  S  T  G  R  S  H  S  Y  C 
AGTGTACCCCAAAGAGCACAGGTCGTAGTCACAGCTATTGCCC
U18708  ,IGHD40*01 #c
 G  D  K  I  V  G  T  P  S  C  D  Y  P  K  L  C  S  S  G  Y V   I
  V  I  K  L  L  G  R  R  A  V  T  T  Q  S  C  A  L  R  D  M  L
   *  *  N  C  W  D  A  E  L  *  L  P  K  A  V  L  F  G  I C  Y 
GGTGATAAAATTGTTGGGACGCCGAGCTGTGACTACCCAAAGCTGTGCTCTTCGGGATATGTTATA
 Y  N  I  S  R  R  A  Q  L  W  V  V  T  A  R  R  P  N  N  F IT
  I  T  Y  P  E  E  H  S  F  G  *  S  Q  L  G  V  P  T  I  L  S
   *  H  I  P  K  S  T  A  L  G  S  H  S  S  A  S  Q  Q  F Y  H 
TATAACATATCCCGAAGAGCACAGCTTTGGGTAGTCACAGCTCGGCGTCCCAACAATTTTATCACC
U18722  ,IGHD41*01 #c
 G  L  M  G  C  E  Y  W  L  C  E  P  R  H  G 
  G  *  W  A  V  S  I  G  C  A  S  P  A  M  
   A  N  G  L  *  V  L  A  V  R  A  P  P  W 
GGGCTAATGGGCTGTGAGTATTGGCTGTGCGAGCCCCGCCATGGT 
 T  M  A  G  L  A  Q  P  I  L  T  A  H  *  P 
  P  W  R  G  S  H  S  Q  Y  S  Q  P  I  S  
   H  G  G  A  R  T  A  N  T  H  S  P  L  A 
ACCATGGCGGGGCTCGCACAGCCAATACTCACAGCCCATTAGCCC
U18683  ,IGHD42*01 #c
 S  E  A  E  N  A  G  C  E  F  G  F  L  C  T  T  D  P  W  A  A
  L  R  L  K  T  P  A  V  N  S  V  S  C  V  R  L  T  L  G  L
   *  G  *  K  R  R  L  *  I  R  F  P  V  Y  D  *  P  L  G  C
 TCTGAGGCTGAAAACGCCGGCTGTGAATTCGGTTTCCTGTGTACGACTGACCCTTGGGCTGCA
 C  S  P  R  V  S  R  T  Q  E  T  E  F  T  A  G  V  F  S  L   R
  A  A  Q  G  S  V  V  H  R  K  P  N  S  Q  P  A  F  S  A  S
   Q  P  K  G  Q  S  Y  T  G  N  R  I  H  S  R  R  F  Q  P   Q 
TGCAGCCCAAGGGTCAGTCGTACACAGGAAACCGAATTCACAGCCGGCGTTTTCAGCCTCAGA
U18690  ,IGHD43*01 #c
 C  R  W  C  V  P  P  R  L 
  A  A  G  V  C  P  P  A  
   P  L  V  C  A  P  P  P 
TGCCGCTGGTGTGTGCCCCCCCGCCTC
 E  A  G  G  H  T  P  A  A 
  R  R  G  G  T  H  Q  R  
   G  G  G  A  H  T  S  G 
GAGGCGGGGGGGCACACACCAGCGGCA
U18695  ,IGHD44*01 #c
 F  R  Q  L  P  W  T  D  Y  S  C  D  P  R  L  C  S  S  A  F  G
  F  G  S  S  R  G  R  I  I  V  V  T  R  V  C  A  P  L  R  L
   S  A  A  P  V  D  G  L  *  L  *  P  A  S  V  L  L  C  V  W  
TTTCGGCAGCTCCCGTGGACGGATTATAGTTGTGACCCGCGTCTGTGCTCCTCTGCGTTTGGT
 T  K  R  R  G  A  Q  T  R  V  T  T  I  I  R  P  R  E  L  P   K 
  P  N  A  E  E  H  R  R  G  S  Q  L  *  S  V  H  G  S  C  R
   Q  T  Q  R  S  T  D  A  G  H  N  Y  N  P  S  T  G  A  A   E  
ACCAAACGCAGAGGAGCACAGACGCGGGTCACAACTATAATCCGTCCACGGGAGCTGCCGAAA
U18712  ,IGHD45*01 #c
 Y  A  M  R  F  F  G  P  T  P  C  S  C  D  G 
  M  P  C  G  F  L  A  R  R  R  A  L  V  T  
   C  H  A  V  F  W  P  D  A  V  L  L  *  R 
TATGCCATGCGGTTTTTTGGCCCGACGCCGTGCTCTTGTGACGGC
 A  V  T  R  A  R  R  R  A  K  K  P  H  G  I 
  P  S  Q  E  H  G  V  G  P  K  N  R  M  A  
   R  H  K  S  T  A  S  G  Q  K  T  A  W  H 
GCCGTCACAAGAGCACGGCGTCGGGCCAAAAAACCGCATGGCATA
U18719  ,IGHD46*01 #c
 F  G  N  K  G  V  L  K  R  D  S  C  D  R  L  E  C  S  P  S  G
  S  V  I  R  G  C  *  S  A  I  V  V  T  D  S  S  A  L  P  L
   R  *  *  G  G  V  E  A  R  *  L  *  P  T  R  V  L  S  L   W 
TTCGGTAATAAGGGGGTGTTGAAGCGCGATAGTTGTGACCGACTCGAGTGCTCTCCCTCTGGT
 T  R  G  R  A  L  E  S  V  T  T  I  A  L  Q  H  P  L  I  T  E
  P  E  G  E  H  S  S  R  S  Q  L  S  R  F  N  T  P  L  L  P
   Q  R  E  S  T  R  V  G  H  N  Y  R  A  S  T  P  P  Y  Y  R
ACCAGAGGGAGAGCACTCGAGTCGGTCACAACTATCGCGCTTCAACACCCCCTTATTACCGAA
U18691  ,IGHD47*01 #c
 W  C  M  T  G  R  S  P  A  Y  N  Y  D  V 
  G  V  *  L  G  D  P  P  L  T  T  M  M  
   V  Y  D  W  E  I  P  R  L  Q  L  *  C 
TGGTGTATGACTGGGAGATCCCCCGCTTACAACTATGATGTA
 Y  I  I  V  V  S  G  G  S  P  S  H  T  P 
  T  S  *  L  *  A  G  D  L  P  V  I  H  
   H  H  S  C  K  R  G  I  S  Q  S  Y  T 
TACATCATAGTTGTAAGCGGGGGATCTCCCAGTCATACACCA
U18694  ,IGHD48*01 #c
 Q  G  W  E  Y  S  D  Y  P  C  A  L  H  R  N  V 
  R  A  G  N  I  V  T  T  P  V  L  F  T  G  M  
   G  L  G  I  *  *  L  P  L  C  S  S  P  E  C 
CAGGGCTGGGAATATAGTGACTACCCCTGTGCTCTTCACCGGAATGTT
 N  I  P  V  K  S  T  G  V  V  T  I  F  P  A  L 
  T  F  R  *  R  A  Q  G  *  S  L  Y  S  Q  P  
   H  S  G  E  E  H  R  G  S  H  Y  I  P  S  P 
AACATTCCGGTGAAGAGCACAGGGGTAGTCACTATATTCCCAGCCCTG
U18720  ,IGHD49*01 #c
 S  R  S  W  C  D  C  N  L  P  N 
  L  V  A  G  V  T  A  I  S  P  
   S  *  L  V  *  L  Q  S  P  Q 
TCTCGTAGCTGGTGTGACTGCAATCTCCCCAAT
 I  G  E  I  A  V  T  P  A  T  R 
  L  G  R  L  Q  S  H  Q  L  R  
   W  G  D  C  S  H  T  S  Y  E 
ATTGGGGAGATTGCAGTCACACCAGCTACGAGA
U18698  ,IGHD50*01 #c
 R  R  Y  S  W  C  G  G  S  C  D  Y  L  K  L  A  E  D  N  S  Y  G
  D  A  T  A  G  V  E  G  A  V  T  T  S  N  S  P  K  T  T  P  M
   T  L  Q  L  V  W  R  E  L  *  L  P  Q  T  R  R  R  Q  L  L   W
CGACGCTACAGCTGGTGTGGAGGGAGCTGTGACTACCTCAAACTCGCCGAAGACAACTCCTATGGA
 S  I  G  V  V  F  G  E  F  E  V  V  T  A  P  S  T  P  A  V  A  S
  P  *  E  L  S  S  A  S  L  R  *  S  Q  L  P  P  H  Q  L  * R
   H  R  S  C  L  R  R  V  *  G  S  H  S  S  L  H  T  S  C  S  V
TCCATAGGAGTTGTCTTCGGCGAGTTTGAGGTAGTCACAGCTCCCTCCACACCAGCTGTAGCGTCG
U18692  ,IGHD51*01 #c
 G  A  R  C  G  S  S  A  V  V  L  C  T  L  N 
  G  P  G  V  D  R  P  L  S  S  S  V  L  L  
   G  Q  V  W  I  V  R  C  R  P  L  Y  S  * 
GGGGCCAGGTGTGGATCGTCCGCTGTCGTCCTCTGTACTCTTAAC
 V  K  S  T  E  D  D  S  G  R  S  T  P  G  P 
  L  R  V  Q  R  T  T  A  D  D  P  H  L  A  
   *  E  Y  R  G  R  Q  R  T  I  H  T  W  P 
GTTAAGAGTACAGAGGACGACAGCGGACGATCCACACCTGGCCCC
U18707  ,IGHD52*01 #c
 G  N  S  C  D  Y  D  L  C  S  L  G  H  T 
  A  I  A  V  T  T  I  C  A  L  W  D  T  
   Q  *  L  *  L  R  S  V  L  F  G  T  H 
GGCAATAGCTGTGACTACGATCTGTGCTCTTTGGGACACACG
 R  V  S  Q  R  A  Q  I  V  V  T  A  I  A 
  V  C  P  K  E  H  R  S  *  S  Q  L  L  
   C  V  P  K  S  T  D  R  S  H  S  Y  C 
CGTGTGTCCCAAAGAGCACAGATCGTAGTCACAGCTATTGCC
U18699  ,IGHD53*01 #c
 G  P  A  G  V  C  G  R  N  C  G  G  T 
  D  R  L  V  S  V  A  A  T  A  E  V  
   T  G  W  C  L  W  P  Q  L  R  R  Y 
GGACCGGCTGGTGTCTGTGGCCGCAACTGCGGAGGTACC
 G  T  S  A  V  A  A  T  D  T  S  R  S 
  V  P  P  Q  L  R  P  Q  T  P  A  G  
   Y  L  R  S  C  G  H  R  H  Q  P  V 
GGTACCTCCGCAGTTGCGGCCACAGACACCAGCCGGTCC
U18710  ,IGHD54*01 #c
 A  V  Y  R  Q  C  A  Y  W  S  C  A  P  A  E 
  Q  C  I  G  N  V  L  T  G  V  V  P  R  R  
   S  V  S  A  M  C  L  L  E  L  C  P  G  G 
GCAGTGTATCGGCAATGTGCTTACTGGAGTTGTGCCCCGGCGGAA
 F  R  R  G  T  T  P  V  S  T  L  P  I  H  C 
  S  A  G  A  Q  L  Q  *  A  H  C  R  Y  T  
   P  P  G  H  N  S  S  K  H  I  A  D  T  L 
TTCCGCCGGGGCACAACTCCAGTAAGCACATTGCCGATACACTGC
U18689  ,IGHD55*01 #c
 A  D  D  V  V  V  R  S  N  Y  G  V  A  C  L  A  G  F 
  P  T  M  W  S  *  G  L  T  T  G  S  P  A  W  R  D  
   R  R  C  G  R  K  V  *  L  R  G  R  L  L  G  G  I 
GCCGACGATGTGGTCGTAAGGTCTAACTACGGGGTCGCCTGCTTGGCGGGATTT
 K  S  R  Q  A  G  D  P  V  V  R  P  Y  D  H  I  V  G 
  N  P  A  K  Q  A  T  P  *  L  D  L  T  T  T  S  S  
   I  P  P  S  R  R  P  R  S  *  T  L  R  P  H  R  R 
AAATCCCGCCAAGCAGGCGACCCCGTAGTTAGACCTTACGACCACATCGTCGGC
U18709  ,IGHD56*01 #c
 N  S  Y  A  C  D  F  G  C  S  W  H 
  I  P  M  P  V  T  S  G  V  L  G  
   F  L  C  L  *  L  R  V  F  L  A 
AATTCCTATGCCTGTGACTTCGGGTGTTCTTGGCAC
 V  P  R  T  P  E  V  T  G  I  G  I 
  C  Q  E  H  P  K  S  Q  A  *  E  
   A  K  N  T  R  S  H  R  H  R  N 
GTGCCAAGAACACCCGAAGTCACAGGCATAGGAATT
U51450  ,IGHD57*01 #c
 G  Y  H  S  G  H  A  T  P  Y  Y 
  D  I  T  A  G  M  L  L  P  I  
   I  S  Q  R  A  C  Y  S  L  L 
GGATATCACAGCGGGCATGCTACTCCCTATTAT
 I  I  G  S  S  M  P  A  V  I  S 
  *  *  G  V  A  C  P  L  *  Y  
   N  R  E  *  H  A  R  C  D  I 
ATAATAGGGAGTAGCATGCCCGCTGTGATATCC
U18697  ,IGHD58*01 #c
 G  I  P  G  V  D  P  L  Y  S  C  D  L  C  S  L  R  V  P  Y  A  V
  G  Y  L  V  W  I  P  C  T  A  V  I  C  A  L  Y  G  Y  L  M  L
   D  T  W  C  G  S  L  V  Q  L  *  S  V  L  F  T  G  T  L  C
CGGGATACCTGGTGTGGATCCCTTGTACAGCTGTGATCTGTGCTCTTTACGGGTACCTTATGCTGTA
 Y  S  I  R  Y  P  *  R  A  Q  I  T  A  V  Q  G  I  H  T  R  Y   P
  T  A  *  G  T  R  K  E  H  R  S  Q  L  Y  K  G  S  T  P  G   I
   Q  H  K  V  P  V  K  S  T  D  H  S  C  T  R  D  P  H  Q  V   S
TACAGCATAAGGTACCCGTAAAGAGCACAGATCACAGCTGTACAAGGGATCCACACCAGGTATCCC
U18723  ,IGHD59*01 #c
  L  A  Q  L  G  C  D  Y  G  C  S  S  R  Y  N  Y  S
   *  P  S  W  A  V  T  T  G  A  L  R  G  T  T  I
    S  P  V  G  L  *  L  R  V  L  F  A  V  Q  L  F
 CTAGCCCAGTTGGGCTGTGACTACGGGTGCTCTTCGCGGTACAACTATTCT 
  R  I  V  V  P  R  R  A  P  V  V  T  A  Q  L  G  *
   E  *  L  Y  R  E  E  H  P  *  S  Q  P  N  W  A
    N  S  C  T  A  K  S  T  R  S  H  S  P  T  G  L
 AGAATAGTTGTACCGCGAAGAGCACCCGTAGTCACAGCCCAACTGGGCTAG
#c: rearranged cDNA


Created: Tuesday, 03-Apr-2012 08:20:21 CEST
Author: Dominique Scaviner

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209 Full text Cover; Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219 Full text; Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207 Full text; Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085 Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056 Full text.
For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.

CNRS Université de Montpellier European Commission
IMGT® Founder and Executive Director Emeritus:
Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr
IMGT® Director:
Sofia Kossida Sofia.Kossida@igh.cnrs.fr
Bioinformatics manager:
Véronique Giudicelli Veronique.Giudicelli@igh.cnrs.fr
Computer manager:
Patrice Duroux Patrice.Duroux@igh.cnrs.fr
Webmaster:
Amélie Houles

Citing IMGT | Warranty disclaimer and copyright notice | Privacy policy and advertisement policy

© Copyright 1995-2017 IMGT®, the international ImMunoGeneTics information system®