Alignment of alleles: Sandbar shark (Carcharhinus plumbeus) IGHD5

For translation of the 3 reading frames in direct and inverted orientations see the overview.

  U50606  ,IGHD5*01              ATCCTTGGGGCGCCTATATATTTA     #c
#c: rearranged cDNA

Created: Tuesday, 03-Apr-2012 08:20:21 CEST
Author: Dominique Scaviner

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209 Full text Cover; Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219 Full text; Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207 Full text; Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085 Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056 Full text.
For any other use please contact Marie-Paule Lefranc

CNRS Université de Montpellier European Commission
IMGT® Founder and Executive Director Emeritus:
Marie-Paule Lefranc
IMGT® Director:
Sofia Kossida
Bioinformatics manager:
Véronique Giudicelli
Computer manager:
Patrice Duroux
Amélie Houles

Citing IMGT | Warranty disclaimer and copyright notice | Privacy policy and advertisement policy

© Copyright 1995-2017 IMGT®, the international ImMunoGeneTics information system®