Alignment of alleles: Human TRAC

The nucleotide between parentheses at the beginning of exons comes from a DONOR-SPLICE (n from ngt). The first nucleotide from an INT-DONOR-SPLICE is underlined (n from ngt).

Exon names are shown between parentheses on the first line.
Cysteine involved in the disulfide bridge are shown in purple.
STOP-CODON is indicated by an asterisk.

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters.
Dashes indicate identical nucleotides. Dots indicate gaps by comparison to the longest sequence. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

importantFirst codon and amino acid at position 1.3 depends on the last nucleotide of the TRA J-REGION (Alignment of alleles: Human (Homo sapiens) TRAJ). This amino acid may be an N (aat), H (cat), D (gat) or Y (tat).

                                                                1.3 1.2 1.1   1   2   3   4   5   6   7   8   9  10  11
                                                                 N   I   Q   N   P   D   P   A   V   Y   Q   L   R   D 
  X02883  ,TRAC*01 (EX1)                                      (A)AT ATC CAG AAC CCT GAC CCT GCC GTG TAC CAG CTG AGA GAC
  X02592  ,TRAC*01,(cDNA)                                     (-)-- --- --- --- --- --- --- --- --- --- --- --- --- ---
  M14858  ,TRAC*01                                            (-)-- --- --- --- --- --- --- --- --- --- --- --- --- ---
  AE000662,TRAC*01                                            (-)-- --- --- --- --- --- --- --- --- --- --- --- --- ---
  M94081  ,TRAC*01                                            (-)-- --- --- --- --- --- --- --- --- --- --- --- --- ---

                                                        ___AB_______                                            ________
                                                       15.1    15.3                                                    
                                         12  13  14  15    15.2      16  17  18  19  20  21  22  23  24  25  26  27  28
                                         S   K                           S   S   D   K   S   V   C   L   F   T   D   F 
  X02883  ,TRAC*01 (EX1)                TCT AAA ... ... ... ... ... ... TCC AGT GAC AAG TCT GTC TGC CTA TTC ACC GAT TTT
  X02592  ,TRAC*01,(cDNA)               --- --- ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- --- --- ---
  M14858  ,TRAC*01                      --- --- ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- --- --- ---
  AE000662,TRAC*01                      --- --- ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- --- --- ---
  M94081  ,TRAC*01                      --- --- ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- --- --- ---

                                        _________BC_____________________                            ___________CD_______
                                                                                                   45.1    45.3    45.5
                                         29  30  31  32  33  34  35  36  39  40  41  42  43  44  45    45.2    45.4    
                                         D   S               Q   T   N   V   S   Q   S   K   D   S                     
  X02883  ,TRAC*01 (EX1)                GAT TCT ... ... ... CAA ACA AAT GTG TCA CAA AGT AAG GAT TCT ... ... ... ... ...
  X02592  ,TRAC*01,(cDNA)               --- --- ... ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ...
  M14858  ,TRAC*01                      --- --- ... ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ...
  AE000662,TRAC*01                      --- --- ... ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ...
  M94081  ,TRAC*01                      --- --- ... ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ...

                                       ________                                _________________________DE_____________
                                           45.7                                84.1    84.3    84.5    84.7    85.6    
                                       45.6      77  78  79  80  81  82  83  84    84.2    84.4    84.6    85.7    85.5
                                                 D   V   Y   I   T   D   K   T   V   L   D   M   R   S           M   D    
  X02883  ,TRAC*01 (EX1)                ... ... GAT GTG TAT ATC ACA GAC AAA ACT GTG CTA GAC ATG AGG TCT ... ... ATG GAC 
  X02592  ,TRAC*01,(cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... --- ---
  M14858  ,TRAC*01                      ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... --- ---
  AE000662,TRAC*01                      ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... --- ---
  M94081  ,TRAC*01                      ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... --- ---

                                       ________________                                                _EF_____        
                                       85.4    85.2                                                    96.1            
                                           85.3    85.1  85  86  87  88  89  90  91  92  93  94  95  96    96.2  97  98
                                         F   K   S   N   S   A   V   A   W   S   N   K   S                                 
  X02883  ,TRAC*01 (EX1)                TTC AAG AGC AAC AGT GCT GTG GCC TGG AGC AAC AAA TCT ... ... ... ... ... ... ...
  X02592  ,TRAC*01,(cDNA)               --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ...
  M14858  ,TRAC*01                      --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ...
  AE000662,TRAC*01                      --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ...
  M94081  ,TRAC*01                      --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ...

                                         99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118
                                                 D   F   A   C   A   N   A   F   N   N           S   I   I   P   E   D 
  X02883  ,TRAC*01 (EX1)                ... ... GAC TTT GCA TGT GCA AAC GCC TTC AAC AAC ... ... AGC ATT ATT CCA GAA GAC
  X02592  ,TRAC*01,(cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- ... ... --- --- --- --- --- ---
  M14858  ,TRAC*01                      ... ... --- --- --- --- --- --- --- --- --- --- ... ... --- --- --- --- --- ---
  AE000662,TRAC*01                      ... ... --- --- --- --- --- --- --- --- --- --- ... ... --- --- --- --- --- ---
  M94081  ,TRAC*01                      ... ... --- --- --- --- --- --- --- --- --- --- ... ... --- --- --- --- --- ---

                                        119 120 121 122 123 124
                                         T   F   F   P   S   P  
  X02883  ,TRAC*01 (EX1)                ACC TTC TTC CCC AGC CCA G
  X02592  ,TRAC*01,(cDNA)               --- --- --- --- --- --- -
  M14858  ,TRAC*01                      --- --- --- --- --- --- -
  AE000662,TRAC*01                      --- --- --- --- --- --- -
  M94081  ,TRAC*01                      --- --- --- --- --- --- -

                                          1   2   3   4   5   6   7   8   9  10  11  12  13  14  15
                                         E   S   S   C   D   V   K   L   V   E   K   S   F   E   T  
  X02592  ,TRAC*01,(cDNA)                -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
  M14859  ,TRAC*01                       -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
  AE000662,TRAC*01                       -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
  M94081  ,TRAC*01                       -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -

                                          1   2   3   4   5   6   7   8   9  10  11  12  13  14  15  16  17  18  19  20
                                         D   T   N   L   N   F   Q   N   L   S   V   I   G   F   R   I   L   L   L   K 
  X02592  ,TRAC*01,(cDNA)                -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
  M14860  ,TRAC*01                       -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
  AE000662,TRAC*01                       -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
  M94081  ,TRAC*01                       -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---

                                         21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36
                                         V   A   G   F   N   L   L   M   T   L   R   L   W   S   S   *  
  X02592  ,TRAC*01,(cDNA)               --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
  M14860  ,TRAC*01                      --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
  AE000662,TRAC*01                      --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
  M94081  ,TRAC*01                      --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -

                        and 3'UTR) 
  X02592  ,TRAC*01  (cDNA)              -------------------------------------------------------------------------------

  M14861,TRAC*01                        -------------------------------------------------------------------------------

  AE000662,TRAC*01                      -------------------------------------------------------------------------------

  M94081  ,TRAC*01                      -------------------------------------------------------------------------------
X02883 ,TRAC*01 GAACTCTCCCACCCCCAAGGAGGTGAAAGCTGCTACCACCTCTGTGCCCCCCCGC-AATGCCACCAACTGGATGGGATCC 160 # # # X02592 ,TRAC*01 ---------T--------------------------------------------GT-----------------.....-- # # # M14861,TRAC*01 ---------T--------------------------------------------GC-----------------.....-- # # # # AE000662,TRAC*01 ---------T--------------------------------------------GC-----.-----------.....-- # # # # M94081 ,TRAC*01 ---------T--------------------------------------------GC-----.-----------.....--
X02883 ,TRAC*01 TACCCGAATTTATGATTAAGATTGCTGAAGAGCTGCCAAACACTGCTGCCACCCCCTCTGTTCCCTTATTGCTGCTTGTC X02592 ,TRAC*01 -------------------------------------------------------------------------------- M14861,TRAC*01 -------------------------------------------------------------------------------- AE000662,TRAC*01 -------------------------------------------------------------------------------- M94081 ,TRAC*01 --------------------------------------------------------------------------------
X02883 ,TRAC*01 ACTGCCTGACATTCACGGCAGAGGCAAGGCTGCTGCAGCCTCCCCTGGCTGTGCACATTCCCTCCTGCTCCCCAGAGACT 320 X02592 ,TRAC*01 -------------------------------------------------------------------------------- M14861,TRAC*01 -------------------------------------------------------------------------------- # AE000662,TRAC*01 ---------------------------------------.---G------------------------------------ # M94081 ,TRAC*01 ---------------------------------------.---G------------------------------------
X02883 ,TRAC*01 GCCTCCGCCATCCCACAGATGATGGATCTTCAGTGGGTTCTCTTGGGCTCTAGGTCCTGGAGAATGTTGTGAGGG-TTTA # X02592 ,TRAC*01 ---------------------------------------------------------------------------G---- # M14861,TRAC*01 ---------------------------------------------------------------------------G---- # AE000662,TRAC*01 ---------------------------------------------------------C-----------------G---- # M94081 ,TRAC*01 ---------------------------------------------------------C-----------------G----
X02883 ,TRAC*01 TTTTTTTTTAATAGTGTTCATAAAGAAATACATAGTATTCTTCTTCTCAAGACGTGGGGGGAAATTATCTCATTATCGAG 480 X02592 ,TRAC*01 -------------------------------------------------------------------------------- M14861,TRAC*01 -------------------------------------------------------------------------------- AE000662,TRAC*01 ----------------------------G--------------------------------------------------- M94081 ,TRAC*01 ----------------------------G---------------------------------------------------
X02883 ,TRAC*01 GCCCTGCTATGCTGTGTGTCTGGGCGTGTTGTATGTCCTGCTGCCGATGCCTTC X02592 ,TRAC*01 ------------------------------------------------------ M14861,TRAC*01 ------------------------------------------------------ AE000662,TRAC*01 ------------------------------------------------------ M94081 ,TRAC*01 ------------------------------------------------------
#: Nucleotide deletion or insertion

A DONOR-SPLICE, located just after the termination codon, uses a dowstream ACCEPTOR-SPLICE, placing part of the 3' non-coding sequence on a separate untranslated exon, designated as EX4.
Since EX4 is untranslated, nucleotide differences observed in EX4 are not taken into account for the description of alleles, according to IMGT allele nomenclature and sequence polymorphisms.
A mutation of the 'g' nucleotide (that follows the STOP-CODON, and corresponds to the 'n' of the 'ngt' DONOR-SPLICE,mutation g>a, leads to a splicing of EX2 to EX4, and therefore to a loss of EX3, and to an immunodeficiency in homozygous indiviuals for the mutation (Morgan N.V. et al., J. Clin. Invest; 121, 695-702 (2011) PMID: 21206088

IMGT note:
(1) Amino acid resulting from the splicing with th TRA J-REGIONs is N (codon aat) for 35 TRAJ, D (codon gat) for 12 TRAJ, Y (codon tat) for 7 TRAJ or H (codon cat) for 4 TRAJ. See Alignment of alleles: Human TRAJ (overview).

This alignement has been generated with the IMGT/AlleleAlign tool developed by Mehdi Yousfi (31/07/2001)

Created: 25/10/1999
Last updated: 27/05/2016
Authors: Géraldine Folch and Nathalie Bosc

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209 Full text Cover; Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219 Full text; Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207 Full text; Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085 Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056 Full text.
For any other use please contact Marie-Paule Lefranc

CNRS Université de Montpellier European Commission
IMGT® Founder and Executive Director Emeritus:
Marie-Paule Lefranc
IMGT® Director:
Sofia Kossida
Bioinformatics manager:
Véronique Giudicelli
Computer manager:
Patrice Duroux
Amélie Houles

Citing IMGT | Warranty disclaimer and copyright notice | Privacy policy and advertisement policy

© Copyright 1995-2018 IMGT®, the international ImMunoGeneTics information system®