Alignment of alleles: Human TRDC

The nucleotide between parentheses at the beginning of exons comes from a DONOR-SPLICE (n from ngt). The first nucleotide from an INT-DONOR-SPLICE is underlined (n from ngt).

Exon names are shown between parentheses on the first line.
Cysteine involved in the disulfide bridge are shown in purple.
STOP-CODON is indicated by an asterisk.

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters.
Dashes indicate identical nucleotides. Dots indicate gaps by comparison to the longest sequence. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Note that AE000661 encompasses M94081.
          Poly(A) signals are shown in green.

                                                                                                               
                                                                    1.2 1.1   1   2   3   4   5   6   7   8   9  10  11
                                                                     R   S   Q   P   H   T   K   P   S   V   F   V   M 
  M22148  ,TRDC*01 (EX1)                                          (C)GA AGT CAG CCT CAT ACC AAA CCA TCC GTT TTT GTC ATG
                                                                                                               
  X07019  ,TRDC*01                                                (-)-- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M94081  ,TRDC*01                                                (-)-- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  AE000661,TRDC*01                                                (-)-- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M20288  ,TRDC*01                                                (-)-- --- --- --- --- --- --- --- --- --- --- --- ---

                                                        ___AB_______                                            ________
                                                       15.1    15.3                                                    
                                         12  13  14  15    15.2      16  17  18  19  20  21  22  23  24  25  26  27  28
                                         K   N   G                               T   N   V   A   C   L   V   K   E   F 
  M22148  ,TRDC*01 (EX1)                AAA AAT GGA ... ... ... ... ... ... ... ACA AAT GTC GCT TGT CTG GTG AAG GAA TTC
                                                                                                               
  X07019  ,TRDC*01                      --- --- --- ... ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M94081  ,TRDC*01                      --- --- --- ... ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  AE000661,TRDC*01                      --- --- --- ... ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- ---
                                                                                                                
  M20288  ,TRDC*01                      --- --- --- ... ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- --- 

                                        _________BC_____________________                            ___________CD_______
                                                                                                   45.1    45.3    45.5
                                         29  30  31  32  33  34  35  36  39  40  41  42  43  44  45    45.2    45.4    
                                         Y   P           K   D   I   R   I   N   L   V   S   S   K   K   I   T   E   F 
  M22148  ,TRDC*01 (EX1)                TAC CCC ... ... AAG GAT ATA AGA ATA AAT CTC GTG TCA TCC AAG AAG ATA ACA GAG TTT
                                                                                                               
  X07019  ,TRDC*01                      --- --- ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M94081  ,TRDC*01                      --- --- ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  AE000661,TRDC*01                      --- --- ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---

                                        ________                                _________________________DE_____________
                                           45.7                                84.1    84.3    84.5    84.7    85.6    
                                       45.6      77  78  79  80  81  82  83  84    84.2    84.4    84.6    85.7    85.5
                                                 D   P   A   I   V   I   S   P   S   G                                 
  M22148  ,TRDC*01 (EX1)                ... ... GAT CCT GCT ATT GTC ATC TCT CCC AGT GGG ... ... ... ... ... ... ... ...
                                                                                                               
  X07019  ,TRDC*01                      ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ... ...
                                                                                                               
  M94081  ,TRDC*01                      ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ... ...
                                                                                                               
  AE000661,TRDC*01                      ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ... ...

                                        ________________                                                _EF_____        
                                       85.4    85.2                                                    96.1            
                                           85.3    85.1  85  86  87  88  89  90  91  92  93  94  95  96    96.2  97  98
                                                 K   Y   N   A   V   K   L   G   K   Y   E   D                         
  M22148  ,TRDC*01 (EX1)                ... ... AAG TAC AAT GCT GTC AAG CTT GGT AAA TAT GAA GAT ... ... ... ... ... ...
                                                                                                               
  X07019  ,TRDC*01                      ... ... --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ...
                                                                                                               
  M94081  ,TRDC*01                      ... ... --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ...
                                                                                                               
  AE000661,TRDC*01                      ... ... --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ...

                                                                _______________________FG___________________________    
                                                                                                                       
                                         99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118
                                         S   N   S   V   T   C   S   V   Q   H   D   N       K   T   V   H   S   T   D 
  M22148  ,TRDC*01 (EX1)                TCA AAT TCA GTG ACA TGT TCA GTT CAA CAC GAC AAT ... AAA ACT GTG CAC TCC ACT GAC
                                                                                                               
  X07019  ,TRDC*01                      --- --- --- --- --- --- --- --- --- --- --- --- ... --- --- --- --- --- --- ---
                                                                                                               
  M94081  ,TRDC*01                      --- --- --- --- --- --- --- --- --- --- --- --- ... --- --- --- --- --- --- ---
                                                                                                               
  AE000661,TRDC*01                      --- --- --- --- --- --- --- --- --- --- --- --- ... --- --- --- --- --- --- ---

                                                               
                                        119 120 121 122 123 124 125 126
                                         F   E   V   K   T   D   S   T  
  M22148  ,TRDC*01 (EX1)                TTT GAA GTG AAG ACA GAT TCT ACA G
                                                                
  X07019  ,TRDC*01                      --- --- --- --- --- --- --- --- -
                                                                
  M94081  ,TRDC*01                      --- --- --- --- --- --- --- --- -
                                                                
  AE000661,TRDC*01                      --- --- --- --- --- --- --- --- -



                                          1   2   3   4   5   6   7   8   9  10  11  12  13  14  15  16  17  18  19  20
                                         D   H   V   K   P   K   E   T   E   N   T   K   Q   P   S   K   S   C   H   K 
  M22149  ,TRDC*01 (EX2)                 AT CAC GTA AAA CCA AAG GAA ACT GAA AAC ACA AAG CAA CCT TCA AAG AGC TGC CAT AAA
                                                                                                               
  M94081  ,TRDC*01                       -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  AE000661,TRDC*01                       -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---

                                         21  22
                                         P   K  
  M22149  ,TRDC*01 (EX2)                CCC AAA G
                                        
  M94081  ,TRDC*01                      --- --- -
                                        
  AE000661,TRDC*01                      --- --- -

        

                                          1   2   3   4   5   6   7   8   9  10  11  12  13  14  15  16  17  18  19  20
                                         S   I   V   H   T   E   K   V   N   M   M   S   L   T   V   L   G   L   R   M 
  M22150  ,TRDC*01 (EX3)                 CC ATA GTT CAT ACC GAG AAG GTG AAC ATG ATG TCC CTC ACA GTG CTT GGG CTA CGA ATG
                                                                                                               
  M94081  ,TRDC*01                       -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  AE000661,TRDC*01                       -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---

                                         21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40
                                         L   F   A   K   T   V   A   V   N   F   L   L   T   A   K   L   F   F   L   *  
  M22150  ,TRDC*01 (EX3)                CTG TTT GCA AAG ACT GTT GCC GTC AAT TTT CTC TTG ACT GCC AAG TTA TTT TTC TTG TAA G
                                                                                                                
  M94081  ,TRDC*01                      --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
                                                                                                                
  AE000661,TRDC*01                      --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -

                               

                                
  M22151  ,TRDC*01 (Untranslated EX4    GCTGACTGGCATGAGGAAGCTACACTCCTGAAGAAACCAAAGGCTTACAAAAATGCATCTCCTTGGCTCTGACTTCTTT
                        and 3'UTR) 
  M94081  ,TRDC*01                      -------------------------------------------------------------------------------
  AE000661,TRDC*01                      -------------------------------------------------------------------------------


  M22151  ,TRDC*01                     GTGATTCAAGTTGACCTGTCATAGCCTTGTTAAAATGGCTGCTAGCCAACCAATTTTTCTTCAAAGACAACAAACCCAGC  160
                                       
  M94081  ,TRDC*01                     ----------------------------------------------------C---------------------------
  AE000661,TRDC*01                     ----------------------------------------------------C---------------------------

  M22151  ,TRDC*01                     TCATCCTCCAGCTTGATGGGAAGACAAAGTCCTGGGGAAGGGGGGTTTATGTCCTAACTGCTTTGTATGCTGTTTTATAA
                                                                 
  M94081  ,TRDC*01                     -------------------------------------------------------------------------------- 
                                                            
  AE000661,TRDC*01                     -------------------------------------------------------------------------------- 
                                                           

  M22151  ,TRDC*01                     AGGGATAGAAGGATATAAAAAGATATAGGACTCTTTTTTTACTCCTACAAGTGATACACTTTGAAAATGATGTTTTGTTC  320 
                                                      
  M94081  ,TRDC*01                     --------------------------------------------------------------------------------
  AE000661,TRDC*01                     --------------------------------------------------------------------------------

                                                                                
  M22151  ,TRDC*01                     CTTTTGACTTTCTTTACCTTTTGAAGTAGAAAGTGGGAACCAACAGGTTCACAGCTTCATTCCTCATGAGGAAAATAGGC
                                                   
  M94081  ,TRDC*01                     -----------------------------------------------------------------------C--------
  AE000661,TRDC*01                     -----------------------------------------------------------------------C--------
                                                                                    
                                                                          
  M22151  ,TRDC*01                     CTTGGGAGAAGAAGAGCGGGTGCCCTTTTATCTAAACATGGAAGGCTCTGCTCAACTGAGCACTAGATTTGCTACAAACC  480
                                      
  M94081  ,TRDC*01                     --------------------------------------------------------------------------------
  AE000661,TRDC*01                     --------------------------------------------------------------------------------
                                                                             
  M22151  ,TRDC*01                     AGCATCATCTTCTTCCTCCTGTCCTCACGGCTTGTCCCACCCTCTATGTTCACTTCAGGAGCCACACTAGAGATTCTGCA
                                       
  M94081  ,TRDC*01                     --------------------------------------------------------------------------------
  AE000661,TRDC*01                     --------------------------------------------------------------------------------
                                                      
                                                                              
  M22151  ,TRDC*01                     TGGCGTGGAGGAC---AAAGTTTCAGCACTTTCTGCCTCTCCTAATACTTTACAAATGAGATTACATTTGAATTTGCTAA  640
                                      
  M94081  ,TRDC*01                     -------------GGA----------------------------------------------------------------
  AE000661,TRDC*01                     -------------GGA----------------------------------------------------------------
                                            
                                                                       
  M22151  ,TRDC*01                     TACTTTATGAGCAGGCAATGAGGTTTCCAAAATCTCATCTAAATACTCTCCAATCTATTAGCAAAAATCAGAGTAAAATA
                                         
  M94081  ,TRDC*01                     --------------------------------------------------------------------------------
  AE000661,TRDC*01                     --------------------------------------------------------------------------------

                                                                               
  M22151  ,TRDC*01                     CAGAGGAAAGGCACTGCTTTCTGTTAATTGATTTAACATGCATGAATTAGCTCCCTCTGAGTTCCAGGCACTATGCTGAG  800
                                      
  M94081  ,TRDC*01                     --------------------------------------------------------------------------------
  AE000661,TRDC*01                     --------------------------------------------------------------------------------

                                                                         
  M22151  ,TRDC*01                     AGTACAAAGAAGACACAAGTCTGCTTTCAAGCAACTCACTGTGAAAGTGTTTTTGAAGGGAGGAACAGAAATGAGACCCC
                                              
  M94081  ,TRDC*01                     --------------------------------------------------------------------------------                  

  AE000661,TRDC*01                     --------------------------------------------------------------------------------


  M22151  ,TRDC*01                     TATCTTTCCCTATAAAAACAACATTTTTACTGTGTTTTGCCTGCCAATCTGTATTTGAAACCATTGGACACTGATTCTCT  960
                                      
  M94081  ,TRDC*01                     ---------------------------------C----------------------------------------------     

  AE000661,TRDC*01                     ---------------------------------C----------------------------------------------

                                     
  M22151  ,TRDC*01                     GGCCTGGGACTTTGGCATTGATGGTTTTCTGCCTTTCTTCTCAGCCTCTGCCTCTATTGCATTTATTAAACTGCATTGTG
                                      
  M94081  ,TRDC*01                     --------------------------------------------------------------------------------     

  AE000661,TRDC*01                     --------------------------------------------------------------------------------
      
                                  
  M22151  ,TRDC*01                    TGC

  M94081  ,TRDC*01                    ---   
  
  AE000661,TRDC*01                    ---
 

A DONOR-SPLICE, located just after the termination codon, uses a dowstream ACCEPTOR-SPLICE, placing part of the 3' non-coding sequence on a separate untranslated exon, designated as EX4.
Since EX4 is untranslated, nucleotide differences observed in EX4 are not taken into account for the description of alleles,
according to IMGT allele nomenclature and sequence polymorphisms.


This alignement has been generated with the IMGT/AlleleAlign tool developed by Mehdi Yousfi (31/07/2001)

Created: 25/10/1999
Last updated: Friday, 27-May-2016 21:03:13 CEST
Authors: Dominique Scaviner and Nathalie Bosc

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209 Full text Cover; Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219 Full text; Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207 Full text; Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085 Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056 Full text.
For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.

CNRS Université de Montpellier European Commission
IMGT® Founder and Executive Director Emeritus:
Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr
IMGT® Director:
Sofia Kossida Sofia.Kossida@igh.cnrs.fr
Bioinformatics manager:
Véronique Giudicelli Veronique.Giudicelli@igh.cnrs.fr
Computer manager:
Patrice Duroux Patrice.Duroux@igh.cnrs.fr
Webmaster:
Amélie Houles

Citing IMGT | Warranty disclaimer and copyright notice | Privacy policy and advertisement policy

© Copyright 1995-2017 IMGT®, the international ImMunoGeneTics information system®