Here you are: IMGT Web resources > IMGT Repertoire > Proteins and alleles

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Clicking on the allele name gives access to the IMGT/GENE-DB.
Clicking on the accession number gives access to the IMGT/LIGM-DB.

                                                                                                             (direct orientation)
                                            1        10        20        30        40        50        60        70        80        90       100       110       120       130       140

                                             R  I  P  *  *  W  L  L  L  H
                                              E  Y  R  D  D  G  Y  C  Y  T
                                               N  T  V  M  M  V  T  A  T
  KT723008 IGHD1-1*01 F   D-REGION gDNA     agaataccgtgatgatggttactgctacacc
                                             R  I  S  *  *  W  L  L  L  H
                                              E  Y  R  D  D  G  Y  C  Y  T
                                               N  I  V  M  M  V  T  A  T
  KT723008 IGHD1-2*01 ORF D-REGION gDNA     agaatatcgtgatgatggttactgctacacc
                                             R  L  S  *  *  W  L  L  L  H  P  Q  *  L  R  P  *  H  K  V  *  P  A  H  R  C  G  A  G  Q  C  I  P  R  G  T  G  L  P
                                              D  Y  R  D  D  G  Y  C  Y  T  H  S  D  S  G  P  D  I  K  S  D  P  H  T  G  V  E  L  A  N  A  S  P  G  A  L  G  S  Q
                                               T  I  V  M  M  V  T  A  T  P  T  V  T  Q  A  L  T  *  S  L  T  R  T  Q  V  W  S  W  P  M  H  P  Q  G  H  W  A  P  K
  KT723008 IGHD1-3*01 ORF D-REGION gDNA     agactatcgtgatgatggttactgctacacccacagtgactcaggccctgacataaagtctgacccgcacacaggtgtggagctggccaatgcatccccaggggcactgggctcccaag
                                             R  I  S  *  *  W  L  L  L  H
                                              E  Y  R  D  D  G  Y  C  Y  T
                                               N  I  V  M  M  V  T  A  T
  KT723008 IGHD1-4*01 F   D-REGION gDNA     agaatatcgtgatgatggttactgctacacc
                                             L  L  *  *  P
                                              Y  Y  S  D  H
                                               T  I  V  T
  KT723008 IGHD2-1*01 F   D-REGION gDNA     ttactatagtgaccac
                                             L  L  *  *  P
                                              Y  Y  S  D  H
                                               T  I  V  T
  KT723008 IGHD2-2*01 F   D-REGION gDNA     ttactatagtgaccac
                                             L  L  *  *  P
                                              Y  Y  S  D  H
                                               T  I  V  T
  KT723008 IGHD2-3*01 F   D-REGION gDNA     ttactatagtgaccac
                                             L  L  *  *  P
                                              Y  Y  S  D  H
                                               T  I  V  T
  KT723008 IGHD2-4*01 F   D-REGION gDNA     ttactatagtgaccac
                                             V  L  W  *  L  L  W  *  L  L  W  Y
                                              Y  C  G  S  Y  C  G  S  Y  Y  G
                                               I  V  V  A  I  V  V  V  I  M  V
  KT723008 IGHD3-1*01 F   D-REGION gDNA     gtattgtggtagctattgtggtagttattatggtac
                                             V  L  W  *  L  L  W  *  L  L  W  Y
                                              Y  C  G  S  Y  C  G  S  Y  Y  G
                                               I  V  V  A  I  V  V  V  I  M  V
  KT723008 IGHD3-3*01 F   D-REGION gDNA     gtattgtggtagctattgtggtagttattatggtac
                                             V  L  W  *  L  L  W  *  L  L  W  Y
                                              Y  C  G  S  Y  C  G  S  Y  Y  G
                                               I  V  V  A  I  V  V  V  I  M  V
  KT723008 IGHD3-4*01 F   D-REGION gDNA     gtattgtggtagctattgtggtagttattatggtac
                                             V  V  I  V  V  M  V  M  V  I  V  M  V  I
                                              *  L  *  W  L  W  L  W  L  *  L  W  L  Y
                                               S  Y  S  G  Y  G  Y  G  Y  S  Y  G  Y
  KT723008 IGHD4-1*01 F   D-REGION gDNA     gtagttatagtggttatggttatggttatagttatggttatac
                                             M  I  R  *  V  W  L  *  L  L  *  C  C  Y
                                              *  Y  D  R  C  G  C  S  Y  C  S  V  A
                                               D  T  I  G  V  V  V  V  I  V  V  L  L
  KT723008 IGHD5-2*01 F   D-REGION gDNA     atgatacgataggtgtggttgtagttattgtagtgttgctac
                                             M  I  R  *  V  W  F  *  L  L  *  C  C  Y
                                              *  Y  D  R  C  G  F  S  Y  C  S  V  A
                                               D  T  I  G  V  V  L  V  I  V  V  L  L
  KT723008 IGHD5-3*01 F   D-REGION gDNA     atgatacgataggtgtggttttagttattgtagtgttgctac
                                             M  I  R  *  V  W  F  *  L  L  *  C  C  Y
                                              *  Y  D  R  C  G  F  S  Y  C  S  V  A
                                               D  T  I  G  V  V  L  V  I  V  V  L  L
  KT723008 IGHD5-4*01 F   D-REGION gDNA     atgatacgataggtgtggttttagttattgtagtgttgctac
                                             V  V  V  I  V  V  M  V  M  V  V  V  M  V  M  V  M  I  I
                                              *  L  L  *  W  L  W  L  W  L  W  L  W  L  W  L  *  L  Y
                                               S  C  Y  S  G  Y  G  Y  G  C  G  Y  G  Y  G  Y  D  Y
  KT723008 IGHD6-2*01 F   D-REGION gDNA     gtagttgttatagtggttatggttatggttgtggttatggttatggttatgattatac
                                             V  V  V  I  V  V  M  V  M  V  M  V  V  V  M  V  M  V  I
                                              *  L  L  *  W  L  W  L  W  L  W  L  W  L  W  L  W  L  Y
                                               S  C  Y  S  G  Y  G  Y  G  Y  G  C  G  Y  G  Y  G  Y
  KT723008 IGHD6-3*01 F   D-REGION gDNA     gtagttgttatagtggttatggttatggttatggttgtggttatggttatggttatac
                                             V  V  V  I  V  V  M  V  M  V  M  V  V  V  M  V  M  V  I
                                              *  L  L  *  W  L  W  L  W  L  W  L  W  L  W  L  W  L  Y
                                               S  C  Y  S  G  Y  G  Y  G  Y  G  C  G  Y  G  Y  G  Y
  KT723008 IGHD6-4*01 F   D-REGION gDNA     gtagttgttatagtggttatggttatggttatggttgtggttatggttatggttatac
                                             V  V  M  V  V  M  V  M  V  V  M  V  V  M  V  M  V  M  V  M  V  I
                                              *  L  W  W  L  W  L  W  W  L  W  L  L  W  L  W  L  W  L  W  L  Y
                                               S  Y  G  G  Y  G  Y  G  G  Y  G  C  Y  G  Y  G  Y  G  Y  G  Y
  KT723008 IGHD7-3*01 F   D-REGION gDNA     gtagttatggtggttatggttatggtggttatggttgttatggttatggttatggttatggttatac
                                             V  V  M  V  V  M  V  M  V  V  M  V  V  M  V  M  V  M  V  M  V  M  V  I
                                              *  L  W  W  L  W  L  W  W  L  W  L  L  W  L  W  L  W  L  W  L  W  L  Y
                                               S  Y  G  G  Y  G  Y  G  G  Y  G  C  Y  G  Y  G  Y  G  Y  G  Y  G  Y
  KT723008 IGHD7-4*01 F   D-REGION gDNA     gtagttatggtggttatggttatggtggttatggttgttatggttatggttatggttatggttatggttatac
                                             V  V  V  L  M  V  I  V  M  V  M  V  V  V  M  V  M  V  V  V  V  M  I  V  M  V  M  V  V  M  V  V  M  V  V  M  V  I  V  V  I  V  I  V  I  L  T  N  I
                                              *  L  S  *  W  L  *  L  W  L  W  L  W  L  W  L  W  L  *  W  L  *  L  L  W  L  W  W  L  W  W  L  W  W  L  W  L  *  *  L  *  L  *  L  Y  L  R  I  Y
                                               S  C  P  D  G  Y  S  Y  G  Y  G  C  G  Y  G  Y  G  C  S  G  Y  D  C  Y  G  Y  G  G  Y  G  G  Y  G  G  Y  G  Y  S  S  Y  S  Y  S  Y  T  Y  E  Y
  KT723008 IGHD8-2*01 F   D-REGION gDNA     gtagttgtcctgatggttatagttatggttatggttgtggttatggttatggttgtagtggttatgattgttatggttatggtggttatggtggttatggtggttatggttatagtagttatagttatagttatacttacgaatatac
                                             E  L  G  G
                                              N  S  V  G
                                               T  R  W  G
  KT723008 IGHD9-1*01 F   D-REGION gDNA     gaactcggtggggc
  AY149283 IGHD9-1*02 ORF D-REGION gDNA (1) --------------
                                             E  L  G  G
                                              N  S  V  G
                                               T  R  W  G
  KT723008 IGHD9-4*01 F   D-REGION gDNA     gaactcggtggggc

                                                                                                             (inverted orientation)
                                            1        10        20        30        40        50        60        70        80        90       100       110       120       130       140

                                             G  V  A  V  T  I  I  T  V  F
                                              V  *  Q  *  P  S  S  R  Y  S
                                               C  S  S  N  H  H  H  G  I
  KT723008 IGHD1-1*01 F   D-REGION gDNA     ggtgtagcagtaaccatcatcacggtattct
                                             G  V  A  V  T  I  I  T  I  F
                                              V  *  Q  *  P  S  S  R  Y  S
                                               C  S  S  N  H  H  H  D  I
  KT723008 IGHD1-2*01 ORF D-REGION gDNA     ggtgtagcagtaaccatcatcacgatattct
                                             L  G  S  P  V  P  L  G  M  H  W  P  A  P  H  L  C  A  G  Q  T  L  C  Q  G  L  S  H  C  G  C  S  S  N  H  H  H  D  S
                                              L  G  A  Q  C  P  W  G  C  I  G  Q  L  H  T  C  V  R  V  R  L  Y  V  R  A  *  V  T  V  G  V  A  V  T  I  I  T  I  V
                                               W  E  P  S  A  P  G  D  A  L  A  S  S  T  P  V  C  G  S  D  F  M  S  G  P  E  S  L  W  V  *  Q  *  P  S  S  R  *  S
  KT723008 IGHD1-3*01 ORF D-REGION gDNA     cttgggagcccagtgcccctggggatgcattggccagctccacacctgtgtgcgggtcagactttatgtcagggcctgagtcactgtgggtgtagcagtaaccatcatcacgatagtct
                                             G  V  A  V  T  I  I  T  I  F
                                              V  *  Q  *  P  S  S  R  Y  S
                                               C  S  S  N  H  H  H  D  I
  KT723008 IGHD1-4*01 F   D-REGION gDNA     ggtgtagcagtaaccatcatcacgatattct
                                             V  V  T  I  V
                                              W  S  L  *  *
                                               G  H  Y  S
  KT723008 IGHD2-1*01 F   D-REGION gDNA     gtggtcactatagtaa
                                             V  V  T  I  V
                                              W  S  L  *  *
                                               G  H  Y  S
  KT723008 IGHD2-2*01 F   D-REGION gDNA     gtggtcactatagtaa
                                             V  V  T  I  V
                                              W  S  L  *  *
                                               G  H  Y  S
  KT723008 IGHD2-3*01 F   D-REGION gDNA     gtggtcactatagtaa
                                             V  V  T  I  V
                                              W  S  L  *  *
                                               G  H  Y  S
  KT723008 IGHD2-4*01 F   D-REGION gDNA     gtggtcactatagtaa
                                             V  P  *  *  L  P  Q  *  L  P  Q  Y
                                              Y  H  N  N  Y  H  N  S  Y  H  N
                                               T  I  I  T  T  T  I  A  T  T  I
  KT723008 IGHD3-1*01 F   D-REGION gDNA     gtaccataataactaccacaatagctaccacaatac
                                             V  P  *  *  L  P  Q  *  L  P  Q  Y
                                              Y  H  N  N  Y  H  N  S  Y  H  N
                                               T  I  I  T  T  T  I  A  T  T  I
  KT723008 IGHD3-3*01 F   D-REGION gDNA     gtaccataataactaccacaatagctaccacaatac
                                             V  P  *  *  L  P  Q  *  L  P  Q  Y
                                              Y  H  N  N  Y  H  N  S  Y  H  N
                                               T  I  I  T  T  T  I  A  T  T  I
  KT723008 IGHD3-4*01 F   D-REGION gDNA     gtaccataataactaccacaatagctaccacaatac
                                             V  *  P  *  L  *  P  *  P  *  P  L  *  L
                                              Y  N  H  N  Y  N  H  N  H  N  H  Y  N  Y
                                               I  T  I  T  I  T  I  T  I  T  T  I  T
  KT723008 IGHD4-1*01 F   D-REGION gDNA     gtataaccataactataaccataaccataaccactataactac
                                             V  A  T  L  Q  *  L  Q  P  H  L  S  Y  H
                                              *  Q  H  Y  N  N  Y  N  H  T  Y  R  I
                                               S  N  T  T  I  T  T  T  T  P  I  V  S
  KT723008 IGHD5-2*01 F   D-REGION gDNA     gtagcaacactacaataactacaaccacacctatcgtatcat
                                             V  A  T  L  Q  *  L  K  P  H  L  S  Y  H
                                              *  Q  H  Y  N  N  *  N  H  T  Y  R  I
                                               S  N  T  T  I  T  K  T  T  P  I  V  S
  KT723008 IGHD5-3*01 F   D-REGION gDNA     gtagcaacactacaataactaaaaccacacctatcgtatcat
                                             V  A  T  L  Q  *  L  K  P  H  L  S  Y  H
                                              *  Q  H  Y  N  N  *  N  H  T  Y  R  I
                                               S  N  T  T  I  T  K  T  T  P  I  V  S
  KT723008 IGHD5-4*01 F   D-REGION gDNA     gtagcaacactacaataactaaaaccacacctatcgtatcat
                                             V  *  S  *  P  *  P  *  P  Q  P  *  P  *  P  L  *  Q  L
                                              Y  N  H  N  H  N  H  N  H  N  H  N  H  N  H  Y  N  N  Y
                                               I  I  I  T  I  T  I  T  T  T  I  T  I  T  T  I  T  T
  KT723008 IGHD6-2*01 F   D-REGION gDNA     gtataatcataaccataaccataaccacaaccataaccataaccactataacaactac
                                             V  *  P  *  P  *  P  Q  P  *  P  *  P  *  P  L  *  Q  L
                                              Y  N  H  N  H  N  H  N  H  N  H  N  H  N  H  Y  N  N  Y
                                               I  T  I  T  I  T  T  T  I  T  I  T  I  T  T  I  T  T
  KT723008 IGHD6-3*01 F   D-REGION gDNA     gtataaccataaccataaccacaaccataaccataaccataaccactataacaactac
                                             V  *  P  *  P  *  P  Q  P  *  P  *  P  *  P  L  *  Q  L
                                              Y  N  H  N  H  N  H  N  H  N  H  N  H  N  H  Y  N  N  Y
                                               I  T  I  T  I  T  T  T  I  T  I  T  I  T  T  I  T  T
  KT723008 IGHD6-4*01 F   D-REGION gDNA     gtataaccataaccataaccacaaccataaccataaccataaccactataacaactac
                                             V  *  P  *  P  *  P  *  P  *  Q  P  *  P  P  *  P  *  P  P  *  L
                                              Y  N  H  N  H  N  H  N  H  N  N  H  N  H  H  N  H  N  H  H  N  Y
                                               I  T  I  T  I  T  I  T  I  T  T  I  T  T  I  T  I  T  T  I  T
  KT723008 IGHD7-3*01 F   D-REGION gDNA     gtataaccataaccataaccataaccataacaaccataaccaccataaccataaccaccataactac
                                             V  *  P  *  P  *  P  *  P  *  P  *  Q  P  *  P  P  *  P  *  P  P  *  L
                                              Y  N  H  N  H  N  H  N  H  N  H  N  N  H  N  H  H  N  H  N  H  H  N  Y
                                               I  T  I  T  I  T  I  T  I  T  I  T  T  I  T  T  I  T  I  T  T  I  T
  KT723008 IGHD7-4*01 F   D-REGION gDNA     gtataaccataaccataaccataaccataaccataacaaccataaccaccataaccataaccaccataactac
                                             V  Y  S  *  V  *  L  *  L  *  L  L  *  P  *  P  P  *  P  P  *  P  P  *  P  *  Q  S  *  P  L  Q  P  *  P  *  P  Q  P  *  P  *  L  *  P  S  G  Q  L
                                              Y  I  R  K  Y  N  Y  N  Y  N  Y  Y  N  H  N  H  H  N  H  H  N  H  H  N  H  N  N  H  N  H  Y  N  H  N  H  N  H  N  H  N  H  N  Y  N  H  Q  D  N  Y
                                               I  F  V  S  I  T  I  T  I  T  T  I  T  I  T  T  I  T  T  I  T  T  I  T  I  T  I  I  T  T  T  T  I  T  I  T  T  T  I  T  I  T  I  T  I  R  T  T
  KT723008 IGHD8-2*01 F   D-REGION gDNA     gtatattcgtaagtataactataactataactactataaccataaccaccataaccaccataaccaccataaccataacaatcataaccactacaaccataaccataaccacaaccataaccataactataaccatcaggacaactac
                                             A  P  P  S
                                              P  H  R  V
                                               P  T  E  F
  KT723008 IGHD9-1*01 F   D-REGION gDNA     gccccaccgagttc
  AY149283 IGHD9-1*02 ORF D-REGION gDNA (1) --------------
                                             A  P  P  S
                                              P  H  R  V
                                               P  T  E  F
  KT723008 IGHD9-4*01 F   D-REGION gDNA     gccccaccgagttc


This alignment of allele is generated by IMGT/OutilAllele (Patrice Duroux and Mehdi Yousfi).

IMGT notes:
  1. (1) The IGHD9-1 gene from AY149283 has a D-REGION identical to IGHD9-1*01 however its 3'D-HEPTAMER (cacaaaa) is different from the 3'D-HEPTAMER (cacagag) from KT723008, leading to a different functionality (ORF instead of functional (F)), for that reason the sequence from AY149283 was assigned to IGHD9-1*02.
Last updated:
Perrine Pégorier