Here you are: IMGT Web resources > IMGT Repertoire > Proteins and alleles

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Clicking on the allele name gives access to the IMGT/GENE-DB.
Clicking on the accession number gives access to the IMGT/LIGM-DB.

                                                            5'->3'                                                   3'<-5'
                                                      (direct orientation)                                     (inverted orientation)
                                          1        10        20        30        40                1        10        20        30        40 
                                          |........|.........|.........|.........|..               |........|.........|.........|.........|..

                                           M  I  R  *  V  W  L  *  L  L  *  C  C  Y                 V  A  T  L  Q  *  L  Q  P  H  L  S  Y  H  
                                            *  Y  D  R  C  G  C  S  Y  C  S  V  A                    *  Q  H  Y  N  N  Y  N  H  T  Y  R  I    
                                             D  T  I  G  V  V  V  V  I  V  V  L  L                    S  N  T  T  I  T  T  T  T  P  I  V  S   
  KT723008 IGHD5-2*01 F D-REGION gDNA     atgatacgataggtgtggttgtagttattgtagtgttgctac               gtagcaacactacaataactacaaccacacctatcgtatcat
     
                                     
                                                                                                                                              
                                                                                                                                              
                                                                                                                                              
  AY559838 IGHD5-2*01 F D-REGION gDNA     ------------------------------------------               ------------------------------------------
                                              



Legend:
*: STOP-CODON

This alignment of allele is generated by IMGT/OutilAllele (Patrice Duroux, Mehdi Yousfi and Perrine Pégorier).

Created:
07/11/2017
Last updated:
11/12/2017
Authors:
Perrine Pégorier