Here you are: IMGT Web resources > IMGT Repertoire > Proteins and alleles

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Clicking on the allele name gives access to the IMGT/GENE-DB.
Clicking on the accession number gives access to the IMGT/LIGM-DB.

                                                                   D-REGION                                                               D-REGION 
                                                                    5'->3'                                                                 3'<-5'
                                                             (direct orientation)                                                  (inverted orientation)
                                              1        10        20        30        40        50                    1        10        20        30        40        50
                                              |........|.........|.........|.........|.........|                     |........|.........|.........|.........|.........|

                                               G  I  T  G  T                                                          I  V  P  V  I 
                                                V  *  L  E  L                                                          *  F  Q  L  Y
                                                 Y  N  W  N  Y                                                          S  S  S  Y  T  
  BK009061 IGHD1S1*01 ORF D-REGION gDNA       ggtataactggaactat                                                      atagttccagttatacc

                                               G  I  T  G  T                                                          V  V  P  V  I
                                                V  *  L  E  L                                                          *  F  Q  L  Y
                                                 Y  N  W  N  Y                                                          S  S  S  Y  T 
  BK009065 IGHD1S5*01 F D-REGION gDNA         ggtataactggaactac                                                      gtagttccagttatacc

                                               G  I  A  G  T                                                          V  V  P  A  I
                                                V  *  L  E  R                                                          S  F  Q  L  Y
                                                 Y  S  W  N  D                                                          R  S  S  Y  T
  BK009070 IGHD1S10*01 F D-REGION gDNA        ggtatagctggaacgac                                                      gtcgttccagctatacc     

                                               G  I  A  G  T                                                          V  V  P  A  I
                                                V  *  L  E  R                                                          S  F  Q  L  Y
                                                 Y  S  W  N  D                                                          R  S  S  Y  T
  BK009076 IGHD1S16*01 F D-REGION gDNA        ggtatagctggaacgac                                                      gtcgttccagctatacc     

                                               G  I  T  G  T                                                          V  V  P  V  I
                                                V  *  L  E  L                                                          *  F  Q  L  Y
                                                 Y  N  W  N  Y                                                          S  S  S  Y  T
  BK009081 IGHD1S21*01 ORF D-REGION gDNA      ggtataactggaactac                                                      gtagttccagttatacc

                                               G  I  T  G  M                                                          V  I  P  V  I
                                                V  *  L  E  *                                                          S  F  Q  L  Y
                                                 Y  N  W  N  D                                                          H  S  S  Y  T
  BK009087 IGHD1S27*01 ORF D-REGION gDNA      ggtataactggaatgac                                                      gtcattccagttatacc

                                               G  T  P  G  T                                                          V  V  P  G  V
                                                E  H  L  E  R                                                          S  F  Q  V  F
                                                  N  T  W  N  D                                                         R  S  R  C  S    
  BK009093 IGHD1S33*01 ORF D-REGION gDNA      ggaacacctggaacgac                                                      gtcgttccaggtgttcc

                                               G  I  V  G  T  T                                                       V  V  V  P  T  I
                                                V  *  W  E  L  Q                                                       L  *  F  P  L  Y
                                                 Y  S  G  N  Y  N                                                       C  S  S  H  Y  T 
  BK009099 IGHD1S39*01 F D-REGION gDNA        ggtatagtgggaactacaac                                                   gttgtagttcccactatacc

                                               R  I  L  Y  *  Y  Y  L  L  C                                           G  I  A  S  S  T  S  T  I  S
                                                G  Y  C  T  S  T  T  C  Y  A                                           A  *  Q  V  V  L  V  Q  Y  P 
                                                 D  I  V  L  V  L  L  A  M                                              H  S  K  *  Y  *  Y  N  I
  BK009062 IGHD2S2*01 ORF D-REGION gDNA       aggatattgtactagtactacttgctatgcc                                        ggcatagcaagtagtactagtacaatatcct

                                               R  I  L  *  *  Y  L  L  L  L                                           G  G  A  V  S  T  T  T  I  F
                                                E  Y  C  S  S  T  Y  C  S  S                                           E  E  Q  *  V  L  L  Q  Y  S 
                                                 N  I  V  V  V  L  T  A  P                                              R  S  S  K  Y  Y  Y  N  I 
  BK009071 IGHD2S11*01 F D-REGION gDNA        agaatattgtagtagtacttactgctcctcc                                        ggaggagcagtaagtactactacaatattct
                                               R  I  L  Y  W  *  W  L  L  C                                           G  I  A  T  T  T  S  T  V  F
                                                E  Y  C  T  G  S  G  C  Y  A                                           A  *  Q  P  L  P  V  Q  Y  S 
                                                 N  T  V  L  V  V  V  A  M                                              H  S  N  H  Y  Q  Y  S  I
  BK009077 IGHD2S17*01 F D-REGION gDNA        agaatactgtactggtagtggttgctatgcc                                        ggcatagcaaccactaccagtacagtattct

                                               R  I  L  *  W  Y  L  L  L  C                                           G  I  A  V  N  T  T  T  I  F
                                                E  Y  C  S  G  I  Y  C  Y  A                                           A  *  Q  *  I  P  L  Q  Y  S 
                                                 N  I  V  V  V  F  T  A  M                                              H  S  S  K  Y  H  Y  N  I
  BK009082 IGHD2S22*01 F D-REGION gDNA        agaatattgtagtggtatttactgctatgcc                                        ggcatagcagtaaataccactacaatattct

                                               S  T  L  *  *  *  W  L  L  L                                           G  G  A  A  T  I  T  T  V  C
                                                A  H  C  S  D  S  G  C  S  S                                           E  E  Q  P  L  S  L  Q  C  A 
                                                 H  T  V  V  I  V  A  A  P                                              R  S  S  H  Y  H  Y  S  V 
  BK009088 IGHD2S28*01 F D-REGION gDNA        agcacactgtagtgatagtggctgctcctcc                                        ggaggagcagccactatcactacagtgtgct

                                               S  I  L  *  W  W  C  L  L  H                                           G  V  A  D  T  T  T  T  I  C
                                                A  Y  C  S  G  G  V  C  Y  T                                           V  *  Q  T  P  P  L  Q  Y  A 
                                                 H  I  V  V  V  V  S  A  T                                              C  S  R  H  H  H  Y  N  M
  BK009094 IGHD2S34*01 F D-REGION gDNA        agcatattgtagtggtggtgtctgctacacc                                        ggtgtagcagacaccaccactacaatatgct

                                               V  L  R  G  *  L  R  L  L  L  H  P  Q  R                               T  L  W  V  *  *  *  P  *  S  S  S  *  Y
                                                Y  Y  E  D  D  Y  G  Y  Y  Y  T  H  S                                  R  C  G  C  N  S  N  R  N  H  P  R  N 
                                                 I  T  R  M  I  T  V  T  I  T  P  T  A                                  A  V  G  V  I  V  T  V  I  I  L  V  I                                 
  BK009066 IGHD3S6*01 F D-REGION gDNA         gtattacgaggatgattacggttactattacacccacagcgt                             acgctgtgggtgtaatagtaaccgtaatcatcctcgtaatac 

                                               V  L  L  *  W  *  L  L  L  P  Q  C                                     T  L  W  *  *  *  L  P  L  *  *  Y
                                                Y  Y  Y  S  G  S  Y  Y  Y  H  S                                        H  C  G  S  N  N  Y  H  Y  S  N 
                                                 I  T  I  V  V  V  I  T  T  T  V                                        T  V  V  V  I  T  T  T  I  V  I
  BK009072 IGHD3S12*01 ORF D-REGION gDNA      gtattactatagtggtagttattactaccacagtgt                                   acactgtggtagtaataactaccactatagtaatac 

                                               V  L  G  *  L  L  *                                                    V  I  I  I  T  P  V
                                                Y  W  G  D  Y  Y  D                                                    S  *  *  S  P  Q  Y
                                                 T  G  V  I  I  M                                                       H  N  N  H  P  S   
  BK009078 IGHD3S18*01 F D-REGION gDNA        gtactggggtgattattatgac                                                 gtcataataatcaccccagtac

                                               V  L  L  *  *  W  L  L  H  P  Q  R                                     T  L  W  V  *  *  P  L  S  *  *  Y
                                                Y  Y  Y  D  S  G  Y  Y  T  H  S                                        R  C  G  C  N  N  H  Y  H  S  N 
                                                 I  T  M  I  V  V  I  T  P  T  A                                        A  V  G  V  I  T  T  I  I  V  I                                 
  BK009083 IGHD3S23*01 ORF D-REGION gDNA      gtattactatgatagtggttattacacccacagcgt                                   acgctgtgggtgtaataaccactatcatagtaatac 

                                               V  L  G  *  L  L  *                                                    V  I  I  I  T  P  V
                                                Y  W  G  D  Y  Y  D                                                    S  *  *  S  P  Q  Y
                                                 T  G  V  I  I  M                                                       H  N  N  H  P  S  
  BK009089 IGHD3S29*01 F D-REGION gDNA        gtactggggtgattattatgac                                                 gtcataataatcaccccagtac

                                               V  L  R  L  R  Y  *  *  S  I  L  N                                     G  L  I  S  T  T  N  I  V  I  V  I
                                                Y  Y  D  Y  D  I  S  S  R  Y  *  T                                     V  *  Y  R  L  L  I  S  *  S  *  Y 
                                                 I  T  I  T  I  L  V  V  D  I  K                                        F  N  I  D  Y  *  Y  R  N  R  N                                   
  BK009095 IGHD3S35*01 ORF D-REGION gDNA      gtattacgattacgatattagtagtcgatattaaacc                                  ggtttaatatcgactactaatatcgtaatcgtaatac

                                               *  L  P  *  L                                                          *  L  W  *  S
                                                D  Y  H  N                                                             S  Y  G  S
                                                 T  T  I  T                                                             V  M  V  V                                                 
  BK009067 IGHD4S7*01 ORF D-REGION gDNA       tgactaccataacta                                                        tagttatggtagtca 

                                               *  L  S  P  C  D  Y  G  N  Y                                           V  V  T  I  V  T  W  *  Q  S
                                                D  C  H  H  V  T  M  V  T                                              *  L  P  *  S  H  G  D  S
                                                 T  V  T  M  *  L  W  *  L                                              S  Y  H  S  H  M  V  T  V 
  BK009073 IGHD4S13*01 ORF D-REGION gDNA      tgactgtcaccatgtgactatggtaactac                                         gtagttaccatagtcacatggtgacagtca

                                               *  I  Q  *  L                                                          V  V  T  V  F
                                                E  Y  S  N  Y                                                          *  L  L  Y  S
                                                 N  T  V  T                                                             S  Y  C  I     
  BK009079 IGHD4S19*01 ORF D-REGION gDNA      tgaatacagtaactac                                                       gtagttactgtattca

                                               *  L  R  *  Q  L                                                       V  A  A  T  V  V
                                                D  Y  G  S  S  Y                                                       *  L  L  P  *  S
                                                 T  T  V  A  A                                                          S  C  Y  R  S   
  BK009084 IGHD4S24*01 F D-REGION gDNA        tgactacggtagcagctac                                                    gtagctgctaccgtagtca

                                               *  L  R  *  L                                                          V  V  T  V  V
                                                D  Y  G  N  Y                                                          *  L  P  *  S
                                                 T  T  V  T                                                             S  Y  R  S   
  BK009090 IGHD4S30*01 F D-REGION gDNA        tgactacggtaactac                                                       gtagttaccgtagtca

                                               *  I  Q  *  L                                                          V  V  T  V  F
                                                E  Y  S  N  Y                                                          *  L  L  Y  S
                                                 N  T  V  T                                                             S  Y  C  I   
  BK009096 IGHD4S36*01 F D-REGION gDNA        tgaatacagtaactac                                                       gtagttactgtattca

                                               V  D  T  V  G  T  V                                                    V  T  V  P  T  V  S
                                                W  I  Q  W  V  Q  L                                                    *  L  Y  P  L  Y  P
                                                 G  Y  S  G  Y  S  Y                                                    N  C  T  H  C  I  H 
  BK009063 IGHD5S3*01 ORF D-REGION gDNA       gtggatacagtgggtacagttac                                                gtaactgtacccactgtatccac

                                               V  D  T  A  T  V                                                       V  T  V  A  V  S
                                                W  I  Q  L  Q  L                                                       *  L  *  L  Y  P
                                                 G  Y  S  Y  S  Y                                                       N  C  S  C  I  H    
  BK009068 IGHD5S8*01 F D-REGION gDNA         gtggatacagctacagttac                                                   gtaactgtagctgtatccac

                                               V  D  T  A  T  V  T  T  V  L  P                                        G  G  K  T  V  V  T  V  A  V  S
                                                W  I  Q  L  Q  L  P  Q  F  C  H                                        V  A  K  L  W  *  L  *  L  Y  P 
                                                 G  Y  S  Y  S  Y  H  S  F  A  T                                        W  Q  N  C  G  N  C  S  C  I  H                                        
  BK009074 IGHD5S14*01 ORF D-REGION gDNA      gtggatacagctacagttaccacagttttgccacc                                    ggtggcaaaactgtggtaactgtagctgtatccac

                                               V  D  T  V  G  T  V                                                    V  T  V  P  T  V  S
                                                W  I  Q  W  V  Q  L                                                    *  L  Y  P  L  Y  P
                                                 G  Y  S  G  Y  S  Y                                                    N  C  T  H  C  I  H 
  BK009085 IGHD5S25*01 ORF D-REGION gDNA      gtggatacagtgggtacagttac                                                gtaactgtacccactgtatccac

                                               V  D  I  A  T  V                                                       V  T  V  A  I  S
                                                W  I  *  L  R  L                                                       *  P  *  L  Y  P
                                                 G  Y  S  Y  G  Y                                                       N  R  S  Y  I  H   
  BK009091 IGHD5S31*01 F D-REGION gDNA        gtggatatagctacggttac                                                   gtaaccgtagctatatccac

                                               G  D  T  V  G  T  V                                                    V  T  V  P  T  V  S
                                                G  I  Q  W  V  Q  L                                                    *  L  Y  P  L  Y  P
                                                 G  Y  S  G  Y  S  Y                                                    N  C  T  H  C  I  P 
  BK009097 IGHD5S37*01 F D-REGION gDNA        ggggatacagtgggtacagttac                                                gtaactgtacccactgtatcccc

                                               G  Y  S  S  G  W  Y                                                    V  P  A  A  A  I  P
                                                G  I  A  A  A  G                                                       Y  Q  P  L  L  Y
                                                 V  *  Q  R  L  V                                                       T  S  R  C  Y  T  
  BK009064 IGHD6S4*01 F D-REGION gDNA         gggtatagcagcggctggtac                                                  gtaccagccgctgctataccc 

                                               G  Y  S  S  W  S                                                       G  P  A  A  I  P
                                                G  I  A  A  G                                                          D  Q  L  L  Y
                                                 V  *  Q  L  V                                                          T  S  C  Y  T   
  BK009069 IGHD6S9*01 F D-REGION gDNA         gggtatagcagctggtcc                                                     ggaccagctgctataccc

                                               G  Y  S  S  R  S                                                       G  S  A  A  I  P
                                                G  I  A  A  D                                                          D  L  L  L  Y
                                                 V  *  Q  Q  I                                                          I  C  C  Y  T   
  BK009075 IGHD6S15*01 ORF D-REGION gDNA      gggtatagcagcagatcc                                                     ggatctgctgctataccc 

                                               G  Y  S  G  S  W  N                                                    V  P  A  A  A  I  P
                                                G  I  A  A  A  G                                                       F  Q  L  P  L  Y 
                                                 V  *  R  Q  L  E                                                       S  S  C  R  Y  T 
  BK009080 IGHD6S20*01 F D-REGION gDNA        gggtatagcggcagctggaac                                                  gttccagctgccgctataccc 

                                               G  Y  S  S  G  W  S                                                    G  P  A  A  A  I  P
                                                G  I  A  A  A  G                                                       D  Q  P  L  L  Y
                                                 V  *  Q  R  L  V                                                       T  S  R  C  Y  T 
  BK009086 IGHD6S26*01 F D-REGION gDNA        gggtatagcagcggctggtcc                                                  ggaccagccgctgctataccc 

                                               G  Y  S  G  G  W  S                                                    G  P  A  T  A  I  P
                                                G  I  A  V  A  G                                                       D  Q  P  P  L  Y
                                                 V  *  R  W  L  V                                                       T  S  H  R  Y  T
  BK009092 IGHD6S32*01 F D-REGION gDNA        gggtatagcggtggctggtcc                                                  ggaccagccaccgctataccc

                                               G  Y  S  S  S  Y                                                       V  A  A  A  I  P
                                                G  I  A  A  A                                                          *  L  L  L  Y
                                                 V  *  Q  Q  L                                                          S  C  C  Y  T   
  BK009098 IGHD6S38*01 F D-REGION gDNA        gggtatagcagcagctac                                                     gtagctgctgctataccc 

                                               L  T  G                                                                S  P  V
                                                *  L  G                                                                P  Q  L
                                                 N  W  G                                                                P  S  *   
  BK009100 IGHD7S40*01 F D-REGION gDNA        ctaactgggga                                                            tccccagttag

This alignment of allele is generated by IMGT/OutilAllele (Patrice Duroux and Mehdi Yousfi).

Last updated:
Laurène Picandet, Perrine Pégorier