Here you are: IMGT Web resources > IMGT Repertoire > Proteins and alleles

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Clicking on the allele name gives access to the IMGT/GENE-DB.
Clicking on the accession number gives access to the IMGT/LIGM-DB.

                                                         D-REGION                                           D-REGION 
                                                          5'->3'                                             3'<-5'
                                                   (direct orientation)                              (inverted orientation)
                                              1        10        20        30                    1        10        20        30
                                              |........|.........|.........|                     |........|.........|.........|

                                               V  L  G  *  L  L  *                                V  I  I  I  T  P  V
                                                Y  W  G  D  Y  Y  D                                S  *  *  S  P  Q  Y
                                                 T  G  V  I  I  M                                   H  N  N  H  P  S  
  BK009089 IGHD3S29*01 F D-REGION gDNA        gtactggggtgattattatgac                             gtcataataatcaccccagtac

This alignment of allele is generated by IMGT/OutilAllele (Patrice Duroux and Mehdi Yousfi).

Last updated:
Laurène Picandet, Perrine Pégorier