Here you are: IMGT Web resources > IMGT Repertoire > Proteins and alleles

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Clicking on the allele name gives access to the IMGT/GENE-DB.
Clicking on the accession number gives access to the IMGT/LIGM-DB.

	
	
	                                                 D-REGION                                           D-REGION
                                                          5'->3'                                             3'<-5'
                                                   (direct orientation)                              (inverted orientation)
                                              1        10        20        30                    1        10        20        30
                                              |........|.........|.........|                     |........|.........|.........|

                                               F  I  T  T  V  V                                   V  T  T  V  V  I
                                                L  L  L  Q  W  *                                   S  P  L  *  *  *
                                                 Y  Y  Y  S  G  D                                   H  H  C  S  N  K
  RatNor_6_chr6 IGHD1-1*01 F D-REGION gDNA    tttattactacagtggtgac                               gtcaccactgtagtaataaa

                                               F  I  T  I  A  A  I  S                             V  D  I  A  A  I  V  I
                                                L  L  L  *  Q  L  Y  L                             *  I  *  L  L  *  *  *
                                                 Y  Y  Y  S  S  Y  I  Y                             R  Y  S  C  Y  S  N  K
  RatNor_6_chr6 IGHD1-2*01 F D-REGION gDNA    tttattactatagcagctatatctac                         gtagatatagctgctatagtaataaa

                                               F  L  T  M  V  A                                   V  A  T  I  V  K
                                                F  *  L  W  *  L                                   *  L  P  *  L  K
                                                 F  N  Y  G  S  Y                                   S  Y  H  S  *  K
  RatNor_6_chr6 IGHD1-3*01 F D-REGION gDNA    tttttaactatggtagctac                               gtagctaccatagttaaaaa

                                               L  T  T  R  V  *  L                                V  V  I  P  G  *  L
                                                *  L  P  G  Y  N  Y                                *  L  Y  P  G  S  *
                                                 N  Y  P  G  I  T                                   S  Y  T  R  V  V
  RatNor_6_chr6 IGHD1-4*01 F D-REGION gDNA    ttaactacccgggtataactac                             gtagttatacccgggtagttaa

                                               L  I  I  *  V  Q  L                                V  V  V  P  I  L  L
                                                *  *  Y  R  Y  N  Y                                *  L  Y  L  Y  Y  *
                                                 N  N  I  G  T  T                                   S  C  T  Y  I  I
  RatNor_6_chr6 IGHD1-5*01 F D-REGION gDNA    ttaataatataggtacaactac                             gtagttgtacctatattattaa

                                               F  M  Y  T  T  D  Y  Y  Y                          V  V  I  I  R  S  I  H  K
                                                L  C  I  L  R  I  I  T                             *  *  *  S  V  V  Y  I
                                                 Y  V  Y  Y  G  L  L  L                             S  N  N  P  *  Y  T  *
  RatNor_6_chr6 IGHD1-6*01 F D-REGION gDNA    tttatgtatactacggattattactac                        gtagtaataatccgtagtatacataaa
  AABR03049813  IGHD1-6*01 F D-REGION gDNA    ---------------------------                        ---------------------------

                                               F  I  L  W  V  -  L                                V  V  I  P  I  V  -
                                                S  Y  Y  G  Y  D  Y                                -  S  Y  P  -  Y  E
                                                 H  T  M  G  M  T                                   S  H  T  H  S  M
  RatNor_6_chr6 IGHD1-7*01 F D-REGION gDNA    ttcatactatgggtatgactac                             gtagtcatacccatagtatgaa
  AABR03049813  IGHD1-7*01 F D-REGION gDNA    ----------------------                             ----------------------

                                               F  L  T  T  V  A                                   V  A  T  V  V  K
                                                F  *  L  Q  *  L                                   *  L  L  *  L  K
                                                 F  N  Y  S  S  Y                                   S  Y  C  S  *  K
  RatNor_6_chr6 IGHD1-8*01 F D-REGION gDNA    tttttaactacagtagctac                               gtagctactgtagttaaaaa
  AABR03049813  IGHD1-8*01 F D-REGION gDNA    --------------------                               --------------------

                                               Y  I  L  W  V  *  L                                V  V  I  P  I  V  C
                                                T  Y  Y  G  Y  N  Y                                *  L  Y  P  *  Y  V
                                                 H  T  M  G  I  T                                   S  Y  T  H  S  M
  RatNor_6_chr6 IGHD1-9*01 F D-REGION gDNA    ttcatactatgggtatgactac                             gtagtcatacccatagtatgaa
  AABR03049813  IGHD1-9*01 F D-REGION gDNA    ----------------------                             ----------------------

                                               F  I  T  T                                         V  V  V  I
                                                L  *  Q  L                                         *  L  L  *
                                                 Y  N  N  Y                                         S  C  Y  K
  RatNor_6_chr6 IGHD1-10*01 F D-REGION gDNA   tttataacaactac                                     gtagttgttataaa
  AABR03049813  IGHD1-10*01 F D-REGION gDNA   --------------                                     --------------

                                               L  T  T  E  G  I  V                                L  T  I  P  S  V  V
                                                *  L  R  R  V  *  *                                S  L  Y  P  P  *  L
                                                 N  Y  G  G  Y  S  E                                H  Y  T  L  R  S  *
  RatNor_6_chr6 IGHD1-11*01 F D-REGION gDNA   ttaactacggagggtatagtgag                            ctcactataccctccgtagttaa
  AABR03051895  IGHD1-11*01 F D-REGION gDNA   -----------------------                            -----------------------

                                               F  I  T  M  M  *  L  L  S                          V  I  I  T  T  S  *  *  *
                                                L  L  L  *  C  S  Y  Y  H                          *  *  *  L  H  H  S  N  K
                                                 Y  Y  Y  D  V  V  I  I                             D  N  N  Y  I  I  V  I
  RatNor_6_chr6 IGHD1-12*01 F D-REGION gDNA   tttattactatgatgtagttattatcac                       gtgataataactacatcatagtaataaa

                                               F  I  T  M  M  V  V  I  T                          V  V  I  T  T  I  I  V  I
                                                L  L  L  *  W  *  L  L  L                          *  *  *  L  P  S  *  *  *
                                                 Y  Y  Y  D  G  S  Y  Y  Y                          S  N  N  Y  H  H  S  N  K
  AABR03053101  IGHD1-12*02 F D-REGION gDNA   tttattactatgatggtagttattactac                      gtagtaataactaccatcatagtaataaa

                                               F  I  T  M  M  V  I  I                             V  I  I  T  I  I  V  I
                                                L  L  L  *  W  L  L  S                             *  *  *  P  S  *  *  *
                                                 Y  Y  Y  D  G  Y  Y  H                             D  N  N  H  H  S  N  K
  AABR03053180  IGHD1-12*03 F D-REGION gDNA   tttattactatgatggttattatcac                         gtgataataaccatcatagtaataaa

                                               R  Y  L                                            V  G  I
                                                D  T  Y                                            *  V  S
                                                 I  P                                               R  Y
  RatNor_6_chr6 IGHD2-1*01 F D-REGION gDNA    agatacctac                                         gtaggtatct

                                               G  Y  L                                            V  G  I
                                                D  T  Y                                            *  V  S
                                                 I  P                                               R  Y
  RatNor_6_chr6 IGHD2-2*01 F D-REGION gDNA    ggatacctac                                         gtaggtatcc

                                               G  Y  V                                            I  H  I
                                                D  M  Y                                            Y  I  S
                                                 I  C                                               T  Y
  RatNor_6_chr6 IGHD2-3*01 ORF D-REGION gDNA  ggatatgtat                                         atacatatcc

                                               G  Y  L                                            V  G  I
                                                D  T  Y                                            *  V  S
                                                 I  P                                               R  Y
  RatNor_6_chr6 IGHD2-4*01 ORF D-REGION gDNA  ggatacctac                                         gtaggtatcc

                                               G  Y  L                                            V  S  I
                                                D  T  Y                                            *  V  S
                                                 I  L                                               K  Y
  RatNor_6_chr6 IGHD2-5*01 F D-REGION gDNA    ggatacttac                                         gtaagtatcc
  AABR03049813  IGHD2-5*01 F D-REGION gDNA    ----------                                         ----------

                                               G  Y  L                                            I  G  I
                                                D  T  Y                                            *  V  S
                                                 I  P                                               R  Y
  RatNor_6_chr6 IGHD2-6*01 F D-REGION gDNA    ggatacctat                                         ataggtatcc
  AABR03049813  IGHD2-6*01 F D-REGION gDNA    ----------                                         ----------

                                               G  Y  L                                            L  D  I
                                                D  I  *                                            *  I  S
                                                 I  S                                               R  Y
  RatNor_6_chr6 IGHD2-7*01 F D-REGION gDNA    ggatatctag                                         ctagatatcc

                                               G  Y  L                                            V  G  I
                                                D  T  Y                                            *  V  S
                                                 I  P                                               R  Y
  RatNor_6_chr6 IGHD2-8*01 ORF D-REGION gDNA  ggatacctac                                         gtaggtatcc
  AABR03049813  IGHD2-8*01 ORF D-REGION gDNA  ----------                                         ----------

                                               P  L  S  A  P  T  Q                                L  G  G  G  T  *  R
                                                L  *  V  P  P  P                                   W  V  G  A  L  R
                                                 S  K  C  P  H  P                                   G  W  G  H  L  E
  RatNor_6_chr6 IGHD3-1*01 F D-REGION gDNA    cctctaagtgcccccacccaa                              cctctaagtgcccccacccaa

                                               P  L  Q  C  T  H  P                                S  G  G  C  T  A  E
                                                L  C  S  A  P  T  R                                R  V  G  A  L  Q  R
                                                 S  A  V  H  P  P                                   G  W  V  H  C  R
  RatNor_6_chr6 IGHD3-2*01 F D-REGION gDNA    cctctgcagtgcacccacccga                             tcgggtgggtgcactgcagagg

                                               P  L  Q  C  P  H  P                                L  G  G  G  T  A  E
                                                L  C  S  A  P  T  Q                                W  V  G  A  L  Q  R
                                                 S  A  V  P  P  P                                   G  W  G  H  C  R
  RatNor_6_chr6 IGHD3-3*01 F D-REGION gDNA    cctctgcagtgcccccacccaa                             ttgggtgggggcactgcagagg

                                               P  L  Q  C  P  Q  P                                L  G  W  G  H  C  R
                                                L  C  S  A  P  N  P                                W  V  G  G  T  A  E
                                                 S  A  V  P  P  T  Q                                G  L  G  A  L  Q  R
  RatNor_6_chr6 IGHD3-4*01 F D-REGION gDNA    cctctgcagtgcccccaacccaa                            ttgggttgggggcactgcagagg
  AABR03049813  IGHD3-4*01 F D-REGION gDNA    -----------------------                            -----------------------

                                               P  L  Q  C  T  H  S                                L  S  G  C  T  A  E
                                                L  C  S  A  P  T  Q                                *  V  G  A  L  Q  R
                                                 S  A  V  H  P  L                                   E  W  V  H  C  R
  RatNor_6_chr6 IGHD3-5*01 F D-REGION gDNA    cctctgcagtgcacccactcaa                             ttgagtgggtgcactgcagagg
  AABR03049813  IGHD3-5*01 F D-REGION gDNA    ----------------------                             ----------------------

                                               P  L  I  A  P  T  Q                                L  G  G  C  N  *  R
                                                L  *  L  H  P  P                                   W  V  G  A  I  R
                                                 S  N  C  T  H  P                                   G  W  V  Q  L  E
  RatNor_6_chr6 IGHD3-6*01 ORF D-REGION gDNA  cctctaattgcacccacccaa                              ttgggtgggtgcaattagagg

                                               P  L  K  C  P  Q  P                                L  G  W  G  H  F  R
                                                L  *  S  A  P  N  P                                W  V  G  G  T  S  E
                                                 S  E  V  P  P  T  Q                                G  L  G  A  L  Q  R
  RatNor_6_chr6 IGHD3-7*01 F D-REGION gDNA    cctctgaagtgcccccaacccaa                            ttgggttgggggcacttcagagg
  AABR03049813  IGHD3-7*01 F D-REGION gDNA    -----------------------                            -----------------------

                                               P  L  Q  Y  P  Q  S                                L  D  W  G  Y  C  R
                                                L  C  S  I  P  N  P                                W  I  G  D  T  A  E
                                                 S  A  V  S  P  I  Q                                G  L  G  I  L  Q  R
  RatNor_6_chr6 IGHD3-8*01 ORF D-REGION gDNA  cctctgcagtatccccaatccaa                            ttggattggggatactgcagagg
  AABR03051895  IGHD3-8*01 ORF D-REGION gDNA  -----------------------                            -----------------------

                                               D  I  I  R  A                                      E  A  R  I  I
                                                I  *  Y  G  L                                      K  P  V  L  Y
                                                 Y  N  T  G  F                                      S  P  Y  Y  I
  RatNor_6_chr6 IGHD4-1*01 F D-REGION gDNA    gatataatacgggcttc                                  gaagcccgtattatatc

                                               G  R  I  L  E                                      V  S  S  I  L
                                                V  E  Y  W  R                                      S  P  V  F  Y
                                                 *  N  T  G  D                                      L  Q  Y  S  T
  RatNor_6_chr6 IGHD4-2*01 F D-REGION gDNA    ggtagaatactggagac                                  gtctccagtattctacc

                                               G  I  I  R  G                                      V  P  R  I  I
                                                V  *  F  G  V                                      Y  P  E  L  Y
                                                 Y  N  S  G  Y                                      T  P  N  Y  T
  RatNor_6_chr6 IGHD4-3*01 F D-REGION gDNA    ggtataattcggggtac                                  gtaccccgaattatacc
  AABR03049813  IGHD4-3*01 F D-REGION gDNA    -----------------                                  -----------------

                                               G  V  I  R  G                                      *  P  R  I  T
                                                V  *  F  G  V                                      N  P  E  L  H
                                                 C  N  S  G  L                                      T  P  N  Y  T
  RatNor_6_chr6 IGHD4-4*01 F D-REGION gDNA    ggtgtaattcggggtta                                  taaccccgaattacacc
  AABR03049813  IGHD4-4*01 F D-REGION gDNA    -----------------                                  -----------------

                                               G  I  I  R  G                                      L  P  R  I  T
                                                V  *  F  G  V                                      Y  P  E  L  Y
                                                 Y  N  S  G  *                                      T  P  N  Y  T
  RatNor_6_chr6 IGHD4-5*01 F D-REGION gDNA    ggtataattcggggtaa                                  ttaccccgaattatacc
  AABR03051895  IGHD4-5*01 F D-REGION gDNA    -----------------                                  -----------------

                                               G  I  F  G  L                                      E  A  Q  I  Y
                                                V  Y  L  G  F                                      K  P  K  Y  T
                                                 Y  I  W  A                                         S  P  N  I
  RatNor_6_chr6 IGHD4-6*01 ORF D-REGION gDNA  ggtatatttgggcttc                                   gaagcccaaatatacc
  AABR03051895  IGHD4-6*01 ORF D-REGION gDNA  ----------------                                   ----------------

                                               L  T  G                                            L  P  V
                                                *  L  G                                            S  Q  L
                                                 N  W  E                                            P  S  *
  RatNor_6_chr6 IGHD5-1*01 F D-REGION gDNA    ctaactgggag                                        ctcccagttag
  M13798        IGHD5-1*01 F D-REGION gDNA    -----------                                        -----------

This alignment of allele is generated by IMGT/OutilAllele (Patrice Duroux and Mehdi Yousfi).

Created:
12/02/2016
Last updated:
15/05/2017
Authors:
Mélanie Arrivet