IMGT Repertoire (IG and TR)

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Dots indicate gaps according to the IMGT unique numbering.
Blanks at the 5' and/or 3' end indicate partial sequences.
Asterisk (*) in the sequence indicate a STOP-CODON.
Letters in red correspond to amino acids which are polymorphic in the other alleles.
Colours are according to Color menu for mutations, Color menu for sequence alignments and Color menu for splicing types.
The nucleotide (s) in bold and colored in purple (splicing frame 1) or green (splicing frame 2) from the DONOR splice site are added at the beginning of the following exon in order to obtain and to complete the first CODON of the DOMAIN or REGION resulting from the splicing site. These first CODONs are in bold and colored in purple (splicing frame 1) or green (splicing frame 2)
N (Asn, asparagine) of potential N-glycosylation sites (NXS/T, where X is different from P), (N-linked glycosylation) is shown in green

Clicking on the allele name gives access to the IMGT/GENE-DB.
Clicking on the accession number gives access to the IMGT/LIGM-DB.

                                                         D-REGION                                           D-REGION 
                                                          5'->3'                                             3'<-5'
                                                   (direct orientation)                              (inverted orientation)
                                              1        10        20        30                    1        10        20        30
                                              |........|.........|.........|                     |........|.........|.........|
                                              
                                               L  T  T  E  G  I  V                                L  T  I  P  S  V  V
                                                *  L  R  R  V  *  *                                S  L  Y  P  P  *  L 
                                                 N  Y  G  G  Y  S  E                                H  Y  T  L  R  S  *
  RatNor_6_chr6 IGHD1-11*01 F D-REGION gDNA   ttaactacggagggtatagtgag                            ctcactataccctccgtagttaa 
  AABR03051895  IGHD1-11*01 F D-REGION gDNA   -----------------------                            -----------------------

This alignment of allele is generated by IMGT/OutilAllele (Patrice Duroux, Mehdi Yousfi and Perrine Pégorier).

Created:: 11/02/2016
Last updated:: 23/02/2016
Authors:: Mélanie Arrivet

IMGT Repertoire (IG and TR)

Alignment of alleles: Norway rat (Rattus norvegicus) IGHD1-11