Here you are: IMGT Web resources > IMGT Repertoire > Proteins and alleles

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Clicking on the allele name gives access to the IMGT/GENE-DB.
Clicking on the accession number gives access to the IMGT/LIGM-DB.

	
	
	                                      
  AJ554303 IGHD1*01   F   D-REGION gDNA     gaattgctatagctatggtgctagttgctatagtgac 
                                                                                                                                                                                                                                                         
  AB513624 IGHD1*02   F   D-REGION gDNA     -------------------------------ga---- 
                                           
  AB513625 IGHD1*02   F   D-REGION gDNA     -------------------------------ga----

This alignment of allele is generated by IMGT/OutilAllele (Patrice Duroux and Mehdi Yousfi).

Created:
20/11/2014
Last updated:
27/05/2016
Authors:
Joumana jabado-Michaloud and Delphine Guiraudou