Alignment of alleles: Mouse (Mus musculus) TRAC

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters.
Dashes indicate identical nucleotides. Dots indicate gaps by comparison to the longest sequence. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

The nucleotide between parentheses at the beginning of exons comes from a DONOR-SPLICE (n from ngt).

Exon names are shown between parentheses on the first line.
The Cysteines involved in the TR EX1 intrachain disulfide bridge are shown with a larger letter C in purple.
Other Cysteines (including those involved in the interchain disulfide bridge) are shown with a larger letter C in black.
STOP-CODON is indicated by an asterisk.

N (Asn, asparagine) of potential N-glycosylation sites (NXS/T, where X is different from P), (N-linked glycosylation) is shown is green (site is underlined in CHS and in pages edited before 14/10/2009).

 First codon and amino acid at position 1.3 depends on the last nucleotide of the TRA J-REGION (Alignment of alleles: Mouse (Mus musculus) TRAJ). This amino acid may be an N (aac), H (cac), D (gac) or Y (tac).

                                                                                                              
                                                                1.3 1.2 1.1   1   2   3   4   5   6   7   8   9  10  11
                                                                 D   I   Q   N   P   E   P   A   V   Y   Q   L   K   D 
  M64239  ,TRAC*01 (EX1)                                      (G)AC ATC CAG AAC CCA GAA CCT GCT GTG TAC CAG TTA AAA GAT
                                                                                                               
  M14506  ,TRAC*01 (cDNA)                                     (-)-- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  X67127  ,TRAC*02 (cDNA)                                     (-)-- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  X01134  ,TRAC*02 (cDNA)                                     (-)-- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M16118  ,TRAC*02 (cDNA)                                     (-)-- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M16119  ,TRAC*02 (cDNA)                                     (-)-- --- --- --- --- --- --- --- --- --- --- --- --- ---

                                                        ___AB_______                                            _______
                                                       15.1    15.3                                                    
                                         12  13  14  15    15.2      16  17  18  19  20  21  22  23  24  25  26  27  28
                                         P   R                           S   Q   D   S   T   L   C   L   F   T   D   F 
  M64239  ,TRAC*01 (EX1)                CCT CGG ... ... ... ... ... ... TCT CAG GAC AGC ACC CTC TGC CTG TTC ACC GAC TTT
                                                                                                               
  M14506  ,TRAC*01 (cDNA)               --- --- ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  X67127  ,TRAC*02 (cDNA)               --- --- ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  X01134  ,TRAC*02 (cDNA)               --- --- ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M16118  ,TRAC*02 (cDNA)               --- --- ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M16119  ,TRAC*02 (cDNA)               --- --- ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- --- --- ---

                                       _________BC_____________________                            ___________CD_______
                                                                                                   45.1    45.3    45.5
                                         29  30  31  32  33  34  35  36  39  40  41  42  43  44  45    45.2    45.4    
                                         D   S               Q   I   N   V   P   K   T   M   E   S                     
  M64239  ,TRAC*01 (EX1)                GAC TCC ... ... ... CAA ATC AAT GTG CCG AAA ACC ATG GAA TCT ... ... ... ... ...
                                                                                                               
  M14506  ,TRAC*01 (cDNA)               --- --- ... ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ...
                                                                                                               
  X67127  ,TRAC*02 (cDNA)               --- --- ... ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ...
                                                                                                               
  X01134  ,TRAC*02 (cDNA)               --- --- ... ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ...
                                                                                                               
  M16118  ,TRAC*02 (cDNA)               --- --- ... ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ...
                                                                                                               
  M16119  ,TRAC*02 (cDNA)               --- --- ... ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ...

                                       ________                                _________________________DE_____________
                                           45.7                                84.1    84.3    84.5    84.7    85.6    
                                       45.6      77  78  79  80  81  82  83  84    84.2    84.4    84.6    85.7    85.5
                                                 G   T   F   I   T   D   K   T   V   L   D   M   K   A           M   D    
  M64239  ,TRAC*01 (EX1)                ... ... GGA ACG TTC ATC ACT GAC AAA ACT GTG CTG GAC ATG AAA GCT ... ... ATG GAT 
                                                                                                               
  M14506  ,TRAC*01 (cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... --- ---
                                                                                                               
  X67127  ,TRAC*02 (cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... --- ---
                                                                                                               
  X01134  ,TRAC*02 (cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... --- ---
                                                                                                               
  M16118  ,TRAC*02 (cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... --- ---
                                                                                                               
  M16119  ,TRAC*02 (cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... --- ---

                                       ________________                                                _EF_____        
                                       85.4    85.2                                                    96.1            
                                           85.3    85.1  85  86  87  88  89  90  91  92  93  94  95  96    96.2  97  98
                                         S   K   S   N   G   A   I   A   W   S   N   Q   T                                 
  M64239  ,TRAC*01 (EX1)                TCC AAG AGC AAT GGG GCC ATT GCC TGG AGC AAC CAG ACA ... ... ... ... ... ... ...
                                                                                                               
  M14506  ,TRAC*01 (cDNA)               --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ...
                                                                                                               
  X67127  ,TRAC*02 (cDNA)               --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ...
                                                                                                               
  X01134  ,TRAC*02 (cDNA)               --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ...
                                                                                                               
  M16118  ,TRAC*02 (cDNA)               --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ...
                                                                                                               
  M16119  ,TRAC*02 (cDNA)               --- --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ...

                                                                _______________________FG___________________________    
                                                                                                                       
                                         99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118
                                                 S   F   T   C   Q   D   I   F   K   E       T   N   A   T   Y   P   S 
  M64239  ,TRAC*01 (EX1)                ... ... AGC TTC ACC TGC CAA GAT ATC TTC AAA GAG ... ACC AAC GCC ACC TAC CCC AGT
                                                                                                               
  M14506  ,TRAC*01 (cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- ... --- --- --- --- --- --- ---
                                                                                                               
  X67127  ,TRAC*02 (cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- ... --- --- --- --- --- --- ---
                                                                                                               
  X01134  ,TRAC*02 (cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- ... --- --- --- --- --- --- ---
                                                                                                               
  M16118  ,TRAC*02 (cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- ... --- --- --- --- --- --- ---
                                                                                                               
  M16119  ,TRAC*02 (cDNA)               ... ... --- --- --- --- --- --- --- --- --- --- ... --- --- --- --- --- --- ---

                                   
                                        119
                                         S  
  M64239  ,TRAC*01 (EX1)                TCA G
                                    
  M14506  ,TRAC*01 (cDNA)               --- -
                                    
  X67127  ,TRAC*02 (cDNA)               --- -
                                    
  X01134  ,TRAC*02 (cDNA)               --- -
                                    
  M16118  ,TRAC*02 (cDNA)               --- -
                                    
  M16119  ,TRAC*02 (cDNA)               --- -



                                          1   2   3   4   5   6   7   8   9  10  11  12  13  14  15
                                         D   V   P   C   D   A   T   L   T   E   K   S   F   E   T  
  M64239  ,TRAC*01 (EX2)                 AC GTT CCC TGT GAT GCC ACG TTG ACT GAG AAA AGC TTT GAA ACA G
                                                                                            
  M14506  ,TRAC*01 (cDNA)                -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
                                                                                            
  X67127  ,TRAC*02 (cDNA)                -- --- --- --- --- --- --- --- --C --- --- --- --- --- --- -
                                                                                            
  X01134  ,TRAC*02 (cDNA)                -- --- --- --- --- --- --- --- --C --- --- --- --- --- --- -
                                                                                            
  M16118  ,TRAC*02 (cDNA)                -- --- --- --- --- --- --- --- --C --- --- --- --- --- --- -
                                                                                            
  M16119  ,TRAC*02 (cDNA)                -- --- --- --- --- --- --- --- --C --- --- --- --- --- --- -





                                          1   2   3   4   5   6   7   8   9  10  11  12  13  14  15  16  17  18  19  20
                                         D   M   N   L   N   F   Q   N   L   S   V   M   G   L   R   I   L   L   L   K 
  M64239  ,TRAC*01 (EX3)                 AT ATG AAC CTA AAC TTT CAA AAC CTG TCA GTT ATG GGA CTC CGA ATC CTC CTG CTG AAA
                                                                                                               
  M14506  ,TRAC*01 (cDNA)                -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  X67127  ,TRAC*02 (cDNA)                -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  X01134  ,TRAC*02 (cDNA)                -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M16118  ,TRAC*02 (cDNA)                -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M16119  ,TRAC*02 (cDNA)                -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---

                                         21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36
                                         V   A   G   F   N   L   L   M   T   L   R   L   W   S   S   *
  M64239  ,TRAC*01 (EX3)                GTA GCC GGA TTT AAC CTG CTC ATG ACG CTG AGG CTG TGG TCC AGT TGA G
                                                                                                
  M14506  ,TRAC*01 (cDNA)               --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
                                                                                                
  X67127  ,TRAC*02 (cDNA)               --- --G --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
                                                                                                
  X01134  ,TRAC*02 (cDNA)               --- --G --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
                                                                                                
  M16118  ,TRAC*02 (cDNA)               --- --G --- --- --- --- --- --- --- --- --- --- --- --- --- --- -
                                                                                                
  M16119  ,TRAC*02 (cDNA)               --- --G --- --- --- --- --- --- --- --- --- --- --- --- --- --- -




  M64239  ,TRAC*01 (Untranslated EX4    GTCTGCAAGACTGACAGAGCCTGACTCCCAAGCTCCATCCTCCTCACCCCTCCGCTCCTTCTTCAAGCCAAAAGGAGCCC
                       and 3'UTR)
  M14506  ,TRAC*01 (cDNA)               --------------------------------------------------------------------------------
                                                                                                                      #
  X67127  ,TRAC*02  (cDNA)              --------------------------------T---G---------------------C-------------------..
                                                                                                                      #
  X01134  ,TRAC*02  (cDNA)              --------------------------------T---G---------------------C-------------------..
                                                                                                                      #
  M16118  ,TRAC*02  (cDNA)              --------------------------------T---G---------------------C-------------------..
                                                                                                                      #
  M16119  ,TRAC*02  (cDNA)              --------------------------------T---G---------------------C-------------------..


  M64239  ,TRAC*01                      TCCCACCTCGTCAAGACGGCTGTCTGGGGTCTGGTTGGCCCTGATTCACAATCCCACCTGGATCTCCCAGATTTGTGAGG   160

  M14506  ,TRAC*01 (cDNA)               --------------------------------------------------------------------------------
                                                       #
  X67127  ,TRAC*02 (cDNA)               ................----------------------------------------------------------------
                                                       #
  X01134  ,TRAC*02 (cDNA)               ................----------------------------------------------------------------
                                                       #                        #
  M16118  ,TRAC*02 (cDNA)               ................------------------------.---------------------------------------
                                                       #
  M16119  ,TRAC*02 (cDNA)               ................----------------------------------------------------------------


  M64239  ,TRAC*01                      AAGGTTGCTGGAGAGCTAAGCACTGCTGCCGCACCCACTCAGCTCCCTCACTGCTGCTGACCATTCACAAAAAA------

  M14506  ,TRAC*01 (cDNA)               ----------
                                                                                                                  #    #
  X67127  ,TRAC*02 (cDNA)               ---------A-----------G----------------------------------------------------AAAAAA 
                                                                                                                  #   #
  X01134  ,TRAC*02 (cDNA)               ---------A-----------G----------------------------------------------------AAAAA- 
                                                                                                                  #   #
  M16118  ,TRAC*02 (cDNA)               ---------A-----------G----------------------------------------------------AAAAA- 
                                                                                                                  #   #
  M16119  ,TRAC*02 (cDNA)               ---------A-----------G----------------------------------------------------AAAAA- 


  M64239  ,TRAC*01                      CGGCAGGGGCGGGGCTTCTCCTGGATCTGAAGACCCCTCCCCCATGGCAGACTCCCCTGTAAAATCTCTTGGAGAATGTT  320

  X67127  ,TRAC*02 (cDNA)               ----------------------------------------------------------A--------------------- 

  X01134  ,TRAC*02 (cDNA)               ----------------------------------------------------------A--------------------- 

  M16118  ,TRAC*02 (cDNA)               ----------------------------------------------------------A--------------------- 

  M16119  ,TRAC*02 (cDNA)               ----------------------------------------------------------A--------------------- 

  
  M64239  ,TRAC*01                      GTAAAAAAAATATCGGTTGTTTTTTGTTTTTTTTTTTTTTGCGGGTTTATTTTTTTAAGCATCCATGAAGAAATGCATAT
                                                #         #         #
  X67127  ,TRAC*02 (cDNA)               -------..----G----...........----------G---------C----------------A------------- 
                                                #         #         #
  X01134  ,TRAC*02 (cDNA)               -------..----G----...........----------G---------C----------------A------------- 
                                                #         #         #
  M16118  ,TRAC*02 (cDNA)               -------..----G----...........----------G---------C----------------A------------- 
                                                #         #         #
  M16119  ,TRAC*02 (cDNA)               -------..----G----...........----------G---------C----------------A------------- 


  M64239  ,TRAC*01                      TACTCTTTCATCAAGGTGTAGAAATTATCTCATTGTCTAGACCCTCCTGCTACTGTGTGTATTGAGCCACATTGTATATT  480

  X67127  ,TRAC*02 (cDNA)               -------------------------------------------------------------------------------- 

  X01134  ,TRAC*02 (cDNA)               -------------------------------------------------------------------------------- 

  M16118  ,TRAC*02 (cDNA)               -------------------------------------------------------------------------------- 
                                                                  # 
  M16119  ,TRAC*02 (cDNA)               --------------------------.----------------------------------------------------- 

  
  M64239  ,TRAC*01                      ATTCTGCTGTCCATGACATCATTAAAGGTGATTCAGAAA

  X67127  ,TRAC*02 (cDNA)               ---------C----------------------------- 

  X01134  ,TRAC*02 (cDNA)               ---------C----------------------------- 

  M16118  ,TRAC*02 (cDNA)               ---------C----------------------------- 
  
  M16119  ,TRAC*02 (cDNA)               ---------C----------------------------- 

  
#: Nucleotide deletion or insertion

A DONOR-SPLICE, located just after the termination codon, uses a dowstream ACCEPTOR-SPLICE, placing part of the 3' non-coding sequence on a separate untranslated exon, designated as EX4.
Since EX4 is untranslated, nucleotide differences observed in EX4 are not taken into account for the description of alleles, according to IMGT allele nomenclature and sequence polymorphisms.


Created: 09/05/2001
Last updated: Friday, 27-May-2016 21:03:15 CEST
Author: Nathalie Bosc

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209 Full text Cover; Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219 Full text; Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207 Full text; Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085 Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056 Full text.
For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.

CNRS Université de Montpellier European Commission
IMGT® Founder and Executive Director Emeritus:
Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr
IMGT® Director:
Sofia Kossida Sofia.Kossida@igh.cnrs.fr
Bioinformatics manager:
Véronique Giudicelli Veronique.Giudicelli@igh.cnrs.fr
Computer manager:
Patrice Duroux Patrice.Duroux@igh.cnrs.fr
Webmaster:
Amélie Houles

Citing IMGT | Warranty disclaimer and copyright notice | Privacy policy and advertisement policy

© Copyright 1995-2017 IMGT®, the international ImMunoGeneTics information system®