Alignment of alleles: Mouse (Mus musculus) TRDC

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters.
Dashes indicate identical nucleotides. Dots indicate gaps by comparison to the longest sequence. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

The nucleotide between parentheses at the beginning of exons comes from a DONOR-SPLICE (n from ngt).

Exon names are shown between parentheses on the first line.
The Cysteines involved in the TR EX1 intrachain disulfide bridge are shown with a larger letter C in purple.
Other Cysteines (including those involved in the interchain disulfide bridge) are shown with a larger letter C in black.
STOP-CODON is indicated by an asterisk.

N (Asn, asparagine) of potential N-glycosylation sites (NXS/T, where X is different from P), (N-linked glycosylation) is shown is green (site is underlined in CHS and in pages edited before 14/10/2009).

Poly(A) signals are shown in green.

                                                                                                               
                                                                   1.2 1.1   1   2   3   4   5   6   7   8   9  10  11
                                                                    E   S   Q   P   P   A   K   P   S   V   F   I   M 
  M23381  ,TRDC*01 (EX1)                                         (G)AA AGC CAG CCT CCG GCC AAA CCA TCT GTT TTC ATC ATG
                                                                                                               
  X17180  ,TRDC*01                                               (-)-- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M64239  ,TRDC*01                                               (-)-- --- --- --- --- --- --- --- --- --- --- --- ---

                                                       ___AB_______                                            ________
                                                      15.1    15.3                                                    
                                        12  13  14  15    15.2      16  17  18  19  20  21  22  23  24  25  26  27  28
                                        K   N   G                               T   N   V   A   C   L   V   K   D   F 
  M23381  ,TRDC*01 (EX1)               AAA AAT GGA ... ... ... ... ... ... ... ACA AAT GTT GCT TGT CTG GTG AAA GAT TTC
                                                                                                               
  X17180  ,TRDC*01                     --- --- --- ... ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M64239  ,TRDC*01                     --- --- --- ... ... ... ... ... ... ... --- --- --- --- --- --- --- --- --- ---

                                       _________BC_____________________                            ___________CD_______
                                                                                                  45.1    45.3    45.5
                                        29  30  31  32  33  34  35  36  39  40  41  42  43  44  45    45.2    45.4    
                                        Y   P           K   E   V   T   I   S   L   R   S   S   K   K   I   V   E   F 
  M23381  ,TRDC*01 (EX1)               TAC CCT ... ... AAA GAG GTG ACT ATA AGT CTC AGA TCA TCC AAG AAG ATT GTG GAA TTC
                                                                                                               
  X17180  ,TRDC*01                     --- --- ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---
                                                                                                               
  M64239  ,TRDC*01                     --- --- ... ... --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---

                                       ________                                _________________________DE_____________
                                          45.7                                84.1    84.3    84.5    84.7    85.6    
                                      45.6      77  78  79  80  81  82  83  84    84.2    84.4    84.6    85.7    85.5
                                                D   P   A   I   V   I   S   P   S   G                                 
  M23381  ,TRDC*01 (EX1)               ... ... GAC CCT GCT ATA GTC ATC TCC CCC AGC GGG ... ... ... ... ... ... ... ...
                                                                                                               
  X17180  ,TRDC*01                     ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ... ...
                                                                                                               
  M64239  ,TRDC*01                     ... ... --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ... ... ...

                                       ________________                                                _EF_____        
                                      85.4    85.2                                                    96.1            
                                          85.3    85.1  85  86  87  88  89  90  91  92  93  94  95  96    96.2  97  98
                                                K   Y   S   A   V   K   L   G   Q   Y   G   D                         
  M23381  ,TRDC*01 (EX1)               ... ... AAG TAC AGT GCT GTC AAG CTT GGT CAG TAT GGA GAT ... ... ... ... ... ...
                                                                    
  X17180  ,TRDC*01                     ... ... --- --- --- --- --- --- --- 
                                                                                                               
  M64239  ,TRDC*01                     ... ... --- --- --- --- --- --- --- --- --- --- --- --- ... ... ... ... ... ...

                                                               _______________________FG___________________________    
                                                                                                                      
                                        99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118
                                        S   N   S   V   T   C   S   V   Q   H   N   S       E   T   V   H   S   T   D 
  M23381  ,TRDC*01 (EX1)               TCG AAT TCA GTG ACA TGT TCA GTT CAG CAC AAC AGT ... GAA ACT GTG CAC TCG ACT GAC
                                                                                                               
  M64239  ,TRDC*01                     --- --- --- --- --- --- --- --- --- --- --- --- ... --- --- --- --- --- --- ---

                                                               
                                       119 120 121 122 123 124 125 126
                                        F   E   P   Y   A   N   S   F  
  M23381  ,TRDC*01 (EX1)               TTT GAA CCA TAT GCA AAT TCT TTC A
                                                                
  M64239  ,TRDC*01                     --- --- --- --- --- --- --- --- -



                                         1   2   3   4   5   6   7   8   9  10  11  12  13  14  15  16  17  18  19  20
                                        D   N   E   K   L   P   E   P   E   N   D   T   Q   I   S   E   P   C   Y   G
  L36133  ,TRDC*01 (EX2)                AT AAT GAA AAA CTA CCA GAA CCT GAA AAT GAC ACA CAA ATT TCA GAG CCT TGC TAT GGC

  M64239  ,TRDC*01                      -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- ---

                                        21  22
                                        P   R
  L36133  ,TRDC*01                     CCA AGA G

  M64239  ,TRDC*01                     --- --- -


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 V T V H T E K V N M M S L T V L G L R L L36134 ,TRDC*01 (EX3) TC ACA GTT CAC ACT GAG AAG GTA AAC ATG ATG TCC CTC ACG GTG CTG GGC CTA CGA CTG M64239 ,TRDC*01 -- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 L F A K T I A I N F L L T V K L F F * L36134 ,TRDC*01 CTG TTT GCC AAG ACC ATT GCC ATC AAT TTT CTC TTG ACT GTT AAG TTA TTC TTT TAA G M64239 ,TRDC*01 --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- --- - L36135 ,TRDC*01 (Untranslated EX4 GTGGGCTGACATGAGGAGACTACGGTTCCTGAAAGAAATCAAAAGCTTAGAAAGATGCTATATCCCAGGCTTCCAACTT and 3'UTR) M64239 ,TRDC*01 ------------------------------------------------------------------------------- CTCAGTGCTTCAGACTGACCCTTCACCACCACATTTAAACAGCTGCTAACAAAACCAGCTTTTCTGTGACAGCAACAAG 160                                                                                                      #                                        --------------------------------------------------------------.---------------- CCTAGCTAATCCTCCAGTCTAGAAGAAAAGCAAAAGCCCTCGGGACCCCCGGCTTTACCTGCTGCTTTATAAAGGCATG                                                                                #                                        ----------------------------------------.-------------------------------------- GGAAGTTATGAAAACAGATCCATTTTATTTTGCCCCCATAATTGGTATACTTTGAAAATGGTGTTTCATCCTTCTTCAT 320                                        ------------------------------------------------------------------------------- TTACCCAGAACTAGGAAGTGGGGACCAGCTTCATTATCCAGGAGGAAATAATCTTGAGAGAGAGAACCCGTATCTTTTT                                        ------------------------------------------------------------------------------- AGCTAAACATGGAAAGCTGTACTCAACTCATCCCTAGCCAGAGCCCCCTCCTCCTCTCCTGAGGCGAGCATGGCCCAGC 480                                        ------------------------------------------------------------------------------- --CCCCCCCCCTTTGTATTTACTCCAATAGTCACACAGGAGAGTTTTCCTAGCAGCACTACGGTGTGAACAATTTTAGC                                        ##                                        TC----------------------------------------------------------------------------- ACTTTCTGTTTCTCCTAATACTTTACAAACAAACTCACACTTGGCTTCCTTAATGCTCTCCAAGCAGACAATAAAGCTT 640                                        ------------------------------------------------------------------------------- CTAAGATCGCATC                                        -------------
#: Nucleotide deletion or insertion.

A DONOR-SPLICE, located just after the termination codon, uses a dowstream ACCEPTOR-SPLICE, placing part of the 3' non-coding sequence on a separate untranslated exon, designated as EX4.
Since EX4 is untranslated, nucleotide differences observed in EX4 are not taken into account for the description of alleles, according to IMGT allele nomenclature and sequence polymorphisms.


Created: 15/02/2000
Last updated: Friday, 27-May-2016 21:03:16 CEST
Author: Nathalie Bosc

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209 Full text Cover; Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219 Full text; Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207 Full text; Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085 Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056 Full text.
For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.

CNRS Université de Montpellier European Commission
IMGT® Founder and Executive Director Emeritus:
Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr
IMGT® Director:
Sofia Kossida Sofia.Kossida@igh.cnrs.fr
Bioinformatics manager:
Véronique Giudicelli Veronique.Giudicelli@igh.cnrs.fr
Computer manager:
Patrice Duroux Patrice.Duroux@igh.cnrs.fr
Webmaster:
Amélie Houles

Citing IMGT | Warranty disclaimer and copyright notice | Privacy policy and advertisement policy

© Copyright 1995-2017 IMGT®, the international ImMunoGeneTics information system®