IMGT Repertoire (IG and TR)

Dots indicate gaps according to the IMGT unique numbering. Blanks at the 5' and/or 3' end indicate partial sequences.

Only the *01 allele of each functional, ORF and in-frame pseudogenes D-REGION is shown.

                                     D-REGION                                                                D-REGION 
                                      5'->3'                                                                  3'<-5'
                               (direct orientation)                                                    (inverted orientation)
                               1        10       20                                                     1        10       20
                               |........|........|                                                      |........|........|
                                V  Q  R  Y  S  F  Y                                                      V  K  G  V  S  L  N
                                 F  K  D  T  P  F                                                         *  K  E  Y  L  * 
                                  S  K  I  L  L  L                                                         K  R  S  I  F  E
DQ400445, IGHD1-1*01, ORF      GTTCAAAGATACTCCTTTTAC                                                    GTAAAAGGAGTATCTTTGAAC

                                I  T  T                                                                  A  V  V
                                 *  L  R                                                                  P  *  L
                                  N  Y  G                                                                  R  S  Y
DQ400445, IGHD1-2*01,  F       ATAACTACGGC                                                              GCCGTAGTTAT

                                Q  Y  S  G                                                               T  R  Y  I
                                 N  I  A  G                                                               P  A  I  L
                                  I  *  R                                                                  P  L  Y
DQ400445, IGHD1-3*01,  F       CAATATAGCGGGT                                                            ACCCGCTATATTG

                                Y  W  G  G                                                               V  P  P  Q
                                 T  G  V  A                                                               C  H  P  S
                                  L  G  W  H                                                               A  T  P  V
DQ400445, IGHD1-4*01,  F       TACTGGGGTGGCAC                                                           GTGCCACCCCAGTA

                                V  D  G                                                                  L  H  P
                                 W  M  E                                                                  S  I  H
                                  G  W                                                                     P  S
DQ400445, IGHD1-5*01,  F       GTGGATGGAG                                                               CTCCATCCAC

                                V  I  A  A  G  V                                                         L  L  Q  L  L  *
                                 L  *  Q  L  E  *                                                         Y  S  S  C  Y  N
                                  Y  S  S  W  S                                                            T  P  A  A  I
DQ400445, IGHD1-6*01,  F       GTTATAGCAGCTGGAGTAG                                                      CTACTCCAGCTGCTATAAC

                                S  R  G  Q                                                               L  A  T  R
                                 R  V  A                                                                  W  P  R
                                  A  W  P                                                                  G  H  A
AF068137, IGHD2-1*01, (F) ~vdj TCGCGTGGCCAA                                                             TTGGCCACGCGA
IMGT notes:
~vdj: VDJ genomic DNA rearranged in the locus.