IMGT Repertoire (IG and TR)

Dots indicate gaps according to the IMGT unique numbering. Blanks at the 5' and/or 3' end indicate partial sequences.

Only the *01 allele of each functional, ORF and in-frame pseudogenes D-REGION is shown.

                                        D-REGION                                                                  D-REGION 
                                         5'->3'                                                                    3'<-5'
                                 (direct orientation)                                                      (inverted orientation)
                         1        10       20       30       40                                    1        10       20       30       40
                         |........|........|........|........|                                     |........|........|........|........|
                          T  I  Q  L  Q  F  G  L  L  I  *  E                                        A  L  K  *  E  A  Q  T  V  T  V  *
                           L  Y  S  Y  S  L  G  F  L  F  E  S                                        L  S  N  K  K  P  K  L  *  L  Y  S
                            Y  T  V  T  V  W  A  S  Y  L  R                                           S  Q  I  R  S  P  N  C  N  C  I
AY872256, IGHD1*01, F    ACTATACAGTTACAGTTTGGGCTTCTTATTTGAGAGC                                     GCTCTCAAATAAGAAGCCCAAACTGTAACTGTATAGT

                          T  I  W  G                                                                A  P  I  *
                           L  Y  G  G                                                                P  P  Y  S
                            Y  M  G                                                                   P  H  I 
AY872256, IGHD2*01, F    ACTATATGGGGGC                                                             GCCCCCATATAGT 

                          I  W  G  G  V                                                             H  P  T  P  Y
                           Y  G  V  G                                                                T  P  P  H
                            M  G  W  G                                                                P  H  P  I
AY872256, IGHD3*01, F    ATATGGGGTGGGGTG                                                           CACCCCACCCCATAT 

                          I  T  T  G                                                                P  P  L  L
                           *  Q  R  G                                                                P  R  C  Y
                            N  N  G                                                                   P  V  V
AY872256, IGHD4*01, F    ATAACAACGGGGG                                                             CCCCCGTTGTTAT 

                          P  Y  S  G                                                                T  P  L  Y
                           H  I  A  G                                                                P  R  Y  M
                            I  *  R  G                                                                P  A  I  W
AY872256, IGHD5*01, F    CCATATAGCGGGGT                                                            ACCCCGCTATATGG 

                          Y  G  S  G                                                                A  T  P  I
                           M  G  V                                                                   P  L  P 
                            W  E  W                                                                   H  S  H  
AY872256, IGHD6*01, F    TATGGGAGTGGC                                                              GCCACTCCCATA 

                          Q  N  N  G                                                                A  V  I  L 
                           R  I  T                                                                   P  L  F
                            E  *  R                                                                   R  Y  S 
AY872256, IGHD7*01, F    CAGAATAACGGC                                                              GCCGTTATTCTG 

                          Y  T  G  S                                                                A  P  S  V
                           T  L  G                                                                   L  P  V
                            H  W  E                                                                   S  Q  C 
AY872256, IGHD8*01, F    TACACTGGGAGC                                                              GCTCCCAGTGTA 

                          Y  G  G  S                                                                A  A  P  I
                           M  G  A                                                                   L  P  P
                            W  G  Q                                                                   C  P  H 
AY872256, IGHD9*01, F    TATGGGGGCAGC                                                              GCTGCCCCCATA