IMGT/LIGM-DB logo
Database contains
176810 sequences
from 346 species

IMGT/LIGM-DB sequence

Version:
1.0-rc2
Database release:
LIGMDB_V12
Citing IMGT/LIGM-DB:
Giudicelli, V. et al., Nucleic Acids Res., 34, D781-D784 (2006). PMID: 16381979 Abstract Full PDF

Views

AF003293 - Annotation

Sections

Accession number AF003293
Secondary accession numbers -
IMGT annotation level by annotators
Definition Mus musculus Ig kappa light chain variable region gene, partial cds.
Species

Mus musculus (house mouse)

Taxons Mus
Sequence length 570
IMGT/LIGM-DB dates 13-FEB-1998
  14-JAN-2013 (v. 11)

OBTENTION

Specificities -
Disease related

IDENTIFICATION

Molecule type gDNA
Configuration type germline
Gene type variable
Molecule entity type V-gene
Functionality type functional
Chain type IG-Light, IG-Light-Kappa-IGK
Structure type regular
Location type
Other keywords antigen receptor, immunoglobulin (IG), Immunoglobulin superfamily (IgSF), promoter

CLASSIFICATION

IMGT Groups
IMGT Subgroups KV9

DESCRIPTION

V-GENE   1..>570
  IMGT_allele IGKV9-120*01
  IMGT_gene IGKV9-120
  cell_line MOPC41
  db_xref taxon:10090
  mol_type genomic DNA
  organism Mus musculus
  strain BALB/c; A/J; Swiss Webster
  tissue_type liver
5'UTR   1..98
OCTAMER   8..15
TATA_BOX   47..52
L-PART1   99..153
  protein_id AAB97638.1
atggacatgagggctcctgcacagatttttggcttcttgttgctcttgtttccag
M D M R A P A Q I F G F L L L L F P
W T * G L L H R F L A S C C S C F Q
G H E G S C T D F W L L V A L V S
atggacatgagggctcctgcacagatttttggcttcttgttgctcttgtttccag
M D M R A P A Q I F G F L L L L F P
W T * G L L H R F L A S C C S C F Q
G H E G S C T D F W L L V A L V S
INIT-CODON   99..101
DONOR-SPLICE   153..155
V-INTRON   154..274
ACCEPTOR-SPLICE   272..276
V-EXON   275..570
  protein_id AAB97638.1
gtaccagatgtgacatccagatgacccagtctccatcctccttatctgcctctctgggagaaagagtcagtctcacttgtcgggcaagtcaggacattggtagtagcttaaactggcttcagcaggaaccagatggaactattaaacgcctgatctacgccacatccagtttagattctggtgtgcccaaaaggttcagtggcagtaggtctgggtcagattattctctcaccatcagcagccttgagtctgaagattttgtagactattactgtctacaatatgctagttctcct
V P D V T S R * P S L H P P Y L P L W E K E S V S L V G Q V R T L V V A * T G F S R N Q M E L L N A * S T P H P V * I L V C P K G S V A V G L G Q I I L S P S A A L S L K I L * T I T V Y N M L V L
Y Q M * H P D D P V S I L L I C L S G R K S Q S H L S G K S G H W * * L K L A S A G T R W N Y * T P D L R H I Q F R F W C A Q K V Q W Q * V W V R L F S H H Q Q P * V * R F C R L L L S T I C * F S
T R C D I Q M T Q S P S S L S A S L G E R V S L T C R A S Q D I G S S L N W L Q Q E P D G T I K R L I Y A T S S L D S G V P K R F S G S R S G S D Y S L T I S S L E S E D F V D Y Y C L Q Y A S S P
gtaccagatgtgacatccagatgacccagtctccatcctccttatctgcctctctgggag
V P D V T S R * P S L H P P Y L P L W E
Y Q M * H P D D P V S I L L I C L S G R
T R C D I Q M T Q S P S S L S A S L G E
aaagagtcagtctcacttgtcgggcaagtcaggacattggtagtagcttaaactggcttc
K E S V S L V G Q V R T L V V A * T G F
K S Q S H L S G K S G H W * * L K L A S
R V S L T C R A S Q D I G S S L N W L Q
agcaggaaccagatggaactattaaacgcctgatctacgccacatccagtttagattctg
S R N Q M E L L N A * S T P H P V * I L
A G T R W N Y * T P D L R H I Q F R F W
Q E P D G T I K R L I Y A T S S L D S G
gtgtgcccaaaaggttcagtggcagtaggtctgggtcagattattctctcaccatcagca
V C P K G S V A V G L G Q I I L S P S A
C A Q K V Q W Q * V W V R L F S H H Q Q
V P K R F S G S R S G S D Y S L T I S S
gccttgagtctgaagattttgtagactattactgtctacaatatgctagttctcct
A L S L K I L * T I T V Y N M L V L
P * V * R F C R L L L S T I C * F S
L E S E D F V D Y Y C L Q Y A S S P
L-PART2   275..285
gtaccagatgt
V P D
Y Q M
T R C
gtaccagatgt
V P D
Y Q M
T R C
V-REGION   286..570
  CDR_length [6.3.7]
  IMGT_allele IGKV9-120*01
  IMGT_gene IGKV9-120
gacatccagatgacccagtctccatcctccttatctgcctctctgggagaaagagtcagtctcacttgtcgggcaagtcaggacattggtagtagcttaaactggcttcagcaggaaccagatggaactattaaacgcctgatctacgccacatccagtttagattctggtgtgcccaaaaggttcagtggcagtaggtctgggtcagattattctctcaccatcagcagccttgagtctgaagattttgtagactattactgtctacaatatgctagttctcct
D I Q M T Q S P S S L S A S L G E R V S L T C R A S Q D I G S S L N W L Q Q E P D G T I K R L I Y A T S S L D S G V P K R F S G S R S G S D Y S L T I S S L E S E D F V D Y Y C L Q Y A S S P
T S R * P S L H P P Y L P L W E K E S V S L V G Q V R T L V V A * T G F S R N Q M E L L N A * S T P H P V * I L V C P K G S V A V G L G Q I I L S P S A A L S L K I L * T I T V Y N M L V L
H P D D P V S I L L I C L S G R K S Q S H L S G K S G H W * * L K L A S A G T R W N Y * T P D L R H I Q F R F W C A Q K V Q W Q * V W V R L F S H H Q Q P * V * R F C R L L L S T I C * F S
gacatccagatgacccagtctccatcctccttatctgcctctctgggagaaagagtcagt
D I Q M T Q S P S S L S A S L G E R V S
T S R * P S L H P P Y L P L W E K E S V
H P D D P V S I L L I C L S G R K S Q S
ctcacttgtcgggcaagtcaggacattggtagtagcttaaactggcttcagcaggaacca
L T C R A S Q D I G S S L N W L Q Q E P
S L V G Q V R T L V V A * T G F S R N Q
H L S G K S G H W * * L K L A S A G T R
gatggaactattaaacgcctgatctacgccacatccagtttagattctggtgtgcccaaa
D G T I K R L I Y A T S S L D S G V P K
M E L L N A * S T P H P V * I L V C P K
W N Y * T P D L R H I Q F R F W C A Q K
aggttcagtggcagtaggtctgggtcagattattctctcaccatcagcagccttgagtct
R F S G S R S G S D Y S L T I S S L E S
G S V A V G L G Q I I L S P S A A L S L
V Q W Q * V W V R L F S H H Q Q P * V *
gaagattttgtagactattactgtctacaatatgctagttctcct
E D F V D Y Y C L Q Y A S S P
K I L * T I T V Y N M L V L
R F C R L L L S T I C * F S
FR1-IMGT   286..363
  AA_IMGT 1 to 26
gacatccagatgacccagtctccatcctccttatctgcctctctgggagaaagagtcagtctcacttgtcgggcaagt
D I Q M T Q S P S S L S A S L G E R V S L T C R A S
T S R * P S L H P P Y L P L W E K E S V S L V G Q
H P D D P V S I L L I C L S G R K S Q S H L S G K
gacatccagatgacccagtctccatcctccttatctgcctctctgggagaaagagtcagt
D I Q M T Q S P S S L S A S L G E R V S
T S R * P S L H P P Y L P L W E K E S V
H P D D P V S I L L I C L S G R K S Q S
ctcacttgtcgggcaagt
L T C R A S
S L V G Q
H L S G K
1st-CYS   352..354
CDR1-IMGT   364..381
  AA_IMGT 27 to 32
caggacattggtagtagc
Q D I G S S
R T L V V
G H W * *
caggacattggtagtagc
Q D I G S S
R T L V V
G H W * *
FR2-IMGT   382..432
  AA_IMGT 39 to 55
ttaaactggcttcagcaggaaccagatggaactattaaacgcctgatctac
L N W L Q Q E P D G T I K R L I Y
* T G F S R N Q M E L L N A * S
K L A S A G T R W N Y * T P D L
ttaaactggcttcagcaggaaccagatggaactattaaacgcctgatctac
L N W L Q Q E P D G T I K R L I Y
* T G F S R N Q M E L L N A * S
K L A S A G T R W N Y * T P D L
CONSERVED-TRP   388..390
CDR2-IMGT   433..441
  AA_IMGT 56 to 58
gccacatcc
A T S
P H
H I
gccacatcc
A T S
P H
H I
FR3-IMGT   442..549
  AA_IMGT 66 to 104,AA 73,81,82 missing
agtttagattctggtgtgcccaaaaggttcagtggcagtaggtctgggtcagattattctctcaccatcagcagccttgagtctgaagattttgtagactattactgt
S L D S G V P K R F S G S R S G S D Y S L T I S S L E S E D F V D Y Y C
V * I L V C P K G S V A V G L G Q I I L S P S A A L S L K I L * T I T
F R F W C A Q K V Q W Q * V W V R L F S H H Q Q P * V * R F C R L L L
agtttagattctggtgtgcccaaaaggttcagtggcagtaggtctgggtcagattattct
S L D S G V P K R F S G S R S G S D Y S
V * I L V C P K G S V A V G L G Q I I L
F R F W C A Q K V Q W Q * V W V R L F S
ctcaccatcagcagccttgagtctgaagattttgtagactattactgt
L T I S S L E S E D F V D Y Y C
S P S A A L S L K I L * T I T
H H Q Q P * V * R F C R L L L
2nd-CYS   547..549
CDR3-IMGT   550..570
  AA_IMGT 105 to 111
ctacaatatgctagttctcct
L Q Y A S S P
Y N M L V L
T I C * F S
ctacaatatgctagttctcct
L Q Y A S S P
Y N M L V L
T I C * F S

Literature references

[]
Moore F.L., Schultz P.G., Ulrich H.D.
Germline diversity within the mouse Igk-V9 gene family
Immunogenetics 47(1):91-95 (1997)
PUBMED: 9382926
DOI: 10.1007/s002510050331
[]
Schultz P.G., Ulrich H.D.
Submitted to the ENA/GenBank/DDBJ databases (1997-05-09)
ZMBH, Universitaet Heidelberg, Im Neuenheimer Feld 282, Heidelberg D-69120, Germany

Database cross-references

Database Identifiers Relation
ENA AF003293
EPD EP11154 , MM_IGKM

Sequence

Length : 570 BP
Composition : 135 A; 131 C; 121 G; 183 T; 0 other

cttaataatt tgcataccct cactgcatcg ccttggggac ttctttatat aacagtcaaa        60
catatcctgt gccattgtca ttgcagtcag gactcagcat ggacatgagg gctcctgcac       120
agatttttgg cttcttgttg ctcttgtttc caggtaaaat gaactaaaat tggaatttca       180
ctgttccact gtggttagtg ttgactggca tttgggggat gtcctctttt atcatgctta       240
tctatgtgga tattcattat gtctccactc ctaggtacca gatgtgacat ccagatgacc       300
cagtctccat cctccttatc tgcctctctg ggagaaagag tcagtctcac ttgtcgggca       360
agtcaggaca ttggtagtag cttaaactgg cttcagcagg aaccagatgg aactattaaa       420
cgcctgatct acgccacatc cagtttagat tctggtgtgc ccaaaaggtt cagtggcagt       480
aggtctgggt cagattattc tctcaccatc agcagccttg agtctgaaga ttttgtagac       540
tattactgtc tacaatatgc tagttctcct                                        570