When several alleles are shown, the nucleotide mutations are indicated in red letters.
These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides.
Dots indicate gaps by comparison to the longest sequence.
Blanks indicate partial sequences (blanks at the 5' and/or 3' end).
X13972/M37277,IGHD5-5*01 GTGGATACAGCTATGGTTAC
X97051 ,IGHD5-5*01 --------------------
AB019441,IGHD5-5*01 --------------------
Sequences of the allele *01 of IGHD5-5 and IGHD5-18 are identical.
Last Updated: Monday, 11-Jul-2011 12:56:55 CEST
Created: 17/10/1997
Author: Dominique Scaviner
Contact: Marie-Paule Lefranc
Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Research, 27, 209-212 (1999) Cover of NAR; Ruiz, M. et al., Nucleic Acids Research, 28, 219-221 (2000); Lefranc, M.-P., Nucleic Acids Research, 29, 207-209 (2001); Lefranc, M.-P., Nucleic Acids Res., 31, 307-310 (2003); Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5, 45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33, D593-D597 (2005) Full text; Lefranc, M.-P. et al., Nucleic Acids Research 2009 37: D1006-D1012; doi:10.1093/nar/gkn838 Full text.
|
IMGT founder and director: Marie-Paule Lefranc
Marie-Paule.Lefranc@igh.cnrs.fr
Bioinformatics manager: Véronique Giudicelli Veronique.Giudicelli@igh.cnrs.fr Computer manager: Patrice Duroux Patrice.Duroux@igh.cnrs.fr Webmaster: Chantal Ginestoux Chantal.Ginestoux@igh.cnrs.fr |
|
|
|
|
Citing IMGT © Copyright 1995-2012 IMGT®, the international ImMunoGeneTics information system® |
|||