Alignment of alleles: Human IGHD5-5

When several alleles are shown, the nucleotide mutations are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps by comparison to the longest sequence. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

For translation of the 3 reading frames in direct and inverted orientations see the overview
   X13972/M37277,IGHD5-5*01   GTGGATACAGCTATGGTTAC      

   X97051  ,IGHD5-5*01        --------------------      

   AB019441,IGHD5-5*01        --------------------      

Sequences of the allele *01 of IGHD5-5 and IGHD5-18 are identical.


This alignement of allele has been generated with the IMGT/AlleleAlign tool developed by Dominique Scaviner (22/02/2002).

Last Updated: Monday, 11-Jul-2011 12:56:55 CEST
Created: 17/10/1997
Author: Dominique Scaviner
Contact: Marie-Paule Lefranc

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Research, 27, 209-212 (1999) Cover of NAR; Ruiz, M. et al., Nucleic Acids Research, 28, 219-221 (2000); Lefranc, M.-P., Nucleic Acids Research, 29, 207-209 (2001); Lefranc, M.-P., Nucleic Acids Res., 31, 307-310 (2003); Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5, 45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33, D593-D597 (2005) Full text; Lefranc, M.-P. et al., Nucleic Acids Research 2009 37: D1006-D1012; doi:10.1093/nar/gkn838 Full text.


IMGT founder and director: Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr
Bioinformatics manager: Véronique Giudicelli Veronique.Giudicelli@igh.cnrs.fr
Computer manager: Patrice Duroux Patrice.Duroux@igh.cnrs.fr
Webmaster: Chantal Ginestoux Chantal.Ginestoux@igh.cnrs.fr
     

Citing IMGT
Warranty disclaimer and copyright notice
Privacy policy and advertisement policy

© Copyright 1995-2012 IMGT®, the international ImMunoGeneTics information system®