Alignment of alleles: Mouse (Mus musculus) IGHD (overview)

Only one sequence for each allele is shown. This set of sequences is part of the IMGT reference directory.
Other known sequences are shown in the individual  Alignments of alleles

When several alleles are shown, the nucleotide mutations are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps by comparison to the longest sequence. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

                                         Direct 5'- 3' orientation                        Inverted orientation
                                           F  I  T  T  V  V  A                            V  A  T  T  V  V  I
                                            L  L  L  R  *  *  L                            *  L  L  P  *  *  *
                                             Y  Y  Y  G  S  S  Y                            S  Y  Y  R  S  N  K
IGHD-FL16.1   J00434  ,IGHD-FL16.1*01     TTTATTACTACGGTAGTAGCTAC                        GTAGCTACTACCGTAGTAATAAA   
                                           F  I  T  T  A                                  V  A  V  V  M
                                            S  L  L  R  L                                  *  P  *  *  *
                                             H  Y  Y  G  Y                                  S  R  S  N  E
IGHD-FL16.2   J00436  ,IGHD-FL16.2*01     TTCATTACTACGGCTAC                              GTAGCCGTAGTAATGAA   
                                           P  T  I  V  T                                  V  V  T  I  V
                                            L  L  *  *  L                                  *  L  L  *  *
                                             Y  Y  S  N  Y                                  S  Y  Y  S  R
IGHD-SP2.x    M60961  ,IGHD-SP2.x*01      CCTACTATAGTAACTAC                              GTAGTTACTATAGTAGG   
                                           S  T  M  V  T                                  V  V  T  I  V
                                            L  L  W  *  L                                  *  L  P  *  *
                                             Y  Y  G  N  Y                                  S  Y  H  S  R
IGHD-SP2.1    M60955  ,IGHD-SP2.1*01      TCTACTATGGTAACTAC                              GTAGTTACCATAGTAGA   
                                           S  T  M  I  T                                  V  V  I  I  V
                                            L  L  *  L  R                                  S  *  S  *  *
                                             Y  Y  D  Y  D                                  R  N  H  S  R
IGHD-SP2.2    J00431  ,IGHD-SP2.2*01      TCTACTATGATTACGAC                              GTCGTAATCATAGTAGA   
                                           S  T  M  V  T                                  V  V  T  I  V
                                            L  L  W  L  R                                  S  *  P  *  *
                                             Y  Y  G  Y  D                                  R  N  H  S  R
IGHD-SP2.3    J00435  ,IGHD-SP2.3*01      TCTACTATGGTTACGAC                              GTCGTAACCATAGTAGA   
                                           S  T  M  V  T                                  V  V  T  I  V
                                            L  L  W  L  R                                  S  *  P  *  *
                                             Y  Y  G  Y  D                                  R  N  H  S  R
IGHD-SP2.4    J00437  ,IGHD-SP2.4*01      TCTACTATGGTTACGAC                              GTCGTAACCATAGTAGA  
                                           S  T  M  V  T                                  V  V  T  I  V
                                            L  L  W  *  L                                  *  L  P  *  *
                                             Y  Y  G  N  Y                                  S  Y  H  S  R
IGHD-SP2.5    J00432  ,IGHD-SP2.5*01      TCTACTATGGTAACTAC                              GTAGTTACCATAGTAGA   
                                           P  T  M  V  T                                  V  V  T  I  V
                                            L  L  W  L  R                                  S  *  P  *  *
                                             Y  Y  G  Y  D                                  R  N  H  S  R
IGHD-SP2.6    J00433  ,IGHD-SP2.6*01      CCTACTATGGTTACGAC                              GTCGTAACCATAGTAGG   
                                           P  T  M  V  T                                  V  V  T  I  V
                                            L  L  W  *  L                                  *  L  P  *  *
                                             Y  Y  G  N  Y                                  S  Y  H  S  R
IGHD-SP2.7    J00438  ,IGHD-SP2.7*01      CCTACTATGGTAACTAC                              GTAGTTACCATAGTAGG   
                                           P  S  M  V  T                                  V  V  T  I  L
                                            L  V  W  *  L                                  *  L  P  Y  *
                                             *  Y  G  N  Y                                  S  Y  H  T  R
IGHD-SP2.8    J00439  ,IGHD-SP2.8*01      CCTAGTATGGTAACTAC                              GTAGTTACCATACTAGG   
                                           S  M  M  V  T                                  V  V  T  I  I
                                            L  *  W  L  L                                  *  *  P  S  *
                                             Y  D  G  Y  Y                                  S  N  H  H   R
IGHD-SP2.9    D13199  ,IGHD-SP2.9*01      TCTATGATGGTTACTAC                              GTAGTAACCATCATAGA   
                                           R  Q  L  G  L                                  V  A  R  A   V
                                            D  S  S  G  Y                                  *  P  E  L  S
                                             T  A  R  A                                     S  P  S  C
IGHD-ST4      M23243  ,IGHD-ST4*01        AGACAGCTCGGGCTAC                               GTAGCCCGAGCTGTCT   
                                           L  T  G                                        V  P  V
                                            *  L  G                                        S  Q  L
                                             N  W  D                                        P  S  *
IGHD-Q52(1)   L32868  ,IGHD-Q52*01        CTAACTGGGAC                                    GTCCCAGTTAG   

IMGT note:
(1) For IGHD-Q52*02, the amino acid changes due to the nucleotide T deletion are shown in red.


Created: 09/03/2000
Author: Géraldine Folch
Contact:
Marie-Paule Lefranc

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Research, 27, 209-212 (1999) Cover of NAR; Ruiz, M. et al., Nucleic Acids Research, 28, 219-221 (2000); Lefranc, M.-P., Nucleic Acids Research, 29, 207-209 (2001); Lefranc, M.-P., Nucleic Acids Res., 31, 307-310 (2003); Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5, 45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33, D593-D597 (2005) Full text; Lefranc, M.-P. et al., Nucleic Acids Research 2009 37: D1006-D1012; doi:10.1093/nar/gkn838 Full text.


IMGT founder and director: Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr
Bioinformatics manager: Véronique Giudicelli Veronique.Giudicelli@igh.cnrs.fr
Computer manager: Patrice Duroux Patrice.Duroux@igh.cnrs.fr
Webmaster: Chantal Ginestoux Chantal.Ginestoux@igh.cnrs.fr
     

Citing IMGT
Warranty disclaimer and copyright notice
Privacy policy and advertisement policy

© Copyright 1995-2012 IMGT®, the international ImMunoGeneTics information system®