When several alleles are shown, the nucleotide mutations are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps by comparison to the longest sequence. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).



                         Direct 5'- 3' orientation                    Inverted orientation

                          E  L  L  *  L  W  C  *  L  L  *  *           V  T  I  A  T  S  T  I  A  I  A  I
                           N  C  Y  S  Y  G  A  S  C  Y  S  D           S  L  *  Q  L  A  P  *  L  *  Q  F
                            I  A  I  A  M  V  L  V  A  I  V              H  Y  S  N  *  H  H  S  Y  S  N
AJ554303,IGHD1*01        GAATTGCTATAGCTATGGTGCTAGTTGCTATAGTGAC        GTCACTATAGCAACTAGCACCATAGCTATAGCAATTC



                          *  L  *  R  L  L  *  R  L                    V  T  A  I  A  T  A  I  V
                           D  Y  S  G  C  Y  S  G  Y                    *  P  L  *  Q  P  L  *  S
                            T  I  A  V  A  I  A  V                       N  R  Y  S  N  R  Y  S
AJ554304,IGHD2*01        TGACTATAGCGGTTGCTATAGCGGTTAC                 GTAACCGCTATAGCAACCGCTATAGTCA

This alignment of allele has been generated with the IMGT/AlleleAlign tool developed by Olivier Elemento (03/06/2002).

IMGT note:
Two nucleotide direct repeats are underlined [1].
Reference:
[1] Sun, J. and Butler, J.E., Immunology, 88, 331-339 (1996).