IMGT reference directory: J-REGION Non-human primates TRBJ set
| ![]() |
The IMGT reference directory contains sets of allele sequences isolated from the IMGT reference sequences. By definition, these sets contain one sequence for each allele.
Authors: Véronique Giudicelli (Veronique.Giudicelli@igh.cnrs.fr) and Marie-Paule Lefranc (Marie-Paule.Lefranc@igh.cnrs.fr)
Software material and data coming from IMGT server may be used for academic research only,
provided that it is referred to IMGT, and cited as "IMGT, the international ImMunoGeneTics
information system® http://www.imgt.org
(Initiator and coordinator: Marie-Paule Lefranc, Montpellier, France)."
References to cite: Lefranc, M.-P. et al.,
Nucleic Acids Research, 27, 209-212 (1999)
Cover of NAR;
Ruiz, M. et al.,
Nucleic Acids Research, 28, 219-221 (2000);
Lefranc, M.-P.,
Nucleic Acids Research, 29, 207-209 (2001), Lefranc, M.-P.,
Nucleic Acids Res., 31, 307-310 (2003)
Full text,
Lefranc, M.-P. et al.,
Nucleic Acids Res., 33, D593-D597 (2005)
Full text.
For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.
Species are designated with "short" names
(the three first letters from the genus and species names):
for Aotus nancymaae (Ma's night monkey): Aotnan
>AF107760_TRBJ1-1*01_Aotnan agaacactgaagctttctttggagaaggcaccaaactcacagttgta >AF107739_TRBJ1-1*02_Aotnan gcaacactgaagctttctttggggaaggcaccaaactcacagttgta >AF107750_TRBJ1-2*01_Aotnan ctaactatgactacaccttcggttcaggaaccaggttaacggttgta >AF107747_TRBJ1-4*01_Aotnan cgactaatgaaaagctgttttttggcagtggaacccagctctctgtctta >AF107741_TRBJ1-5*01_Aotnan gggcaatcaggcacagcattttggagatgggactcgactctccgtccta >AF107740_TRBJ1-6*01_Aotnan ggactataattcacccctccattttgggaacgggaccaggctcactgtgaca >AF107754_TRBJ2-1*01_Aotnan ctcctacaatgagcagttcttcgggccagggacacggctcaccgtgcta >AF107759_TRBJ2-1*02_Aotnan ggggtacaatgagcagttcttcgggccagggacacagctcaccgtgcta >AF107743_TRBJ2-2*01_Aotnan gtaacaccgcacagctgttctttggagagggctctaggctgaccgtgctg >AF107751_TRBJ2-3*01_Aotnan ggaacagatccgctgtatttcggcccaggcacccggctgaccgtgctc >AF107756_TRBJ2-4*01_Aotnan tagccaaaacactcagtacttcggcgcggggacccggctctcggtgctg >AF107748_TRBJ2-5*01_Aotnan gaaaagagacccagtacttcgggccaggcacgcggctcctggtgctc
-> IMGT/V-QUEST Search page
-> IMGT Repertoire
-> IMGT Scientific chart
-> IMGT Home page
© Copyright 1995-2007 IMGT, the international ImMunoGeneTics database