IMGT reference directory: V-REGION Teleostei IGHV set


The IMGT reference directory contains sets of allele sequences isolated from the IMGT reference sequences. By definition, these sets contain one sequence for each allele.


Authors: Véronique Giudicelli (Veronique.Giudicelli@igh.cnrs.fr) and Marie-Paule Lefranc (Marie-Paule.Lefranc@igh.cnrs.fr)

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209 Full text Cover; Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219 Full text; Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207 Full text; Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085 Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056 Full text.
For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.


Species are designated with "short" names (the three first letters from the genus and species names):

for Anarhichas minor (Spotted wolffish): Anamin
for Carassius auratus (Goldfish): Caraur
for Danio rerio (Zebrafish): Danrer
for Elops saurus (Ladyfish): Elosau
for Gadus morhua (Atlantic cod): Gadmor
for Ictalurus punctatus (Channel catfish): Ictpun
for Oncorhynchus mykiss (Rainbow trout): Oncmyk
for Paralichthys olivaceus (Bastard halibut): Paroli
for Salvelinus alpinus (Charr): Salalp
for Scophthalmus maximus (Turbot): Scomax
for Salmo salar (Atlantic salmon): Salsal
for Trematomus bernachii (Emerald rockcod): Treber
for Takifugu rubripes (Torafugu):Takrub
for Chaenocephalus aceratus (Blackfin icefish):Chaace
for Notothenia corriceps(Yellowbelly rockcod):Notcor




>AF138958|IGHV1S1*01_Anamin|(F)|V-REGION
TGTGAACAGTTGACACAG......ACAGACTCT...GAGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATGCTCTTAGC...............AGCTACAACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAACATACT............GGAGCTTCATACTACAAAGATTCACTGAAG...AACAAGTTCAGC
ATCGACTTAGAGACTTCCAGCAAAACAGTGACTCTAAACGGACAGAACGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGATCT
>AY188780|IGHV1S2*01_Anamin|(F)|V-REGION
TGTGAACAGTTGACACAG......CCAGACTAT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATGCTCTTAGC...............AGCTACTACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAATATACG............GGAGATTCATACTTCAAAGATTCACTGAAG...AACAAGTTCAGT
ATCGACTTAGACACTTCCAGCAAAACAGTGACTCTAACTGGACAGAACATGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGAGAC
>AY188783|IGHV1S3*01_Anamin|(F)|V-REGION
TGTGAACAGTTGACACAG......CCAGCCTCT...GAGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATGCTCTTAGC...............AGCTACTACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAATATACT............GGAGCTTCATACTACAAAGATTCACTGAAG...AACAAGTTCAGT
ATCGATTTAGACACTTCCAGCAAAACAGTGACTCTAACTGGACAGAACGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGATAT
>AY188784|IGHV1S4*01_Anamin|(F)|V-REGION
TGTGAACAGTTGACACAG......ACAGACTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATTCTCTTAGC...............AGCTACAACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAACATACT............GGAGCTTCATACTACAAAGATTCACTGAAG...AACAAGTTCAGC
ATCGACTTAGACACTTCCAGCAAAACAGTGACTCTAACTGGACAGAACGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGAGGA
>AY188781|IGHV1S5*01_Anamin|(F)|V-REGION
........GTTGACACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATGCTCTTAGC...............AGCTACTACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGATATGCCGCTGTT.........GGAAACACAGCATACTACAAAGATTCACTGAAG...AACAAGTTCAGT
ATCGACTTAGACACTTCCAGCAAAACAGTGACTCTAACTGGACAGAACGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGAGGG
>AY188788 |IGHV1S6*01_Anamin|(F)|V-REGION
TGTGAACAGTTGACACAG......CCAGCCTCT...GAGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATGGTCTT..................AACTACTACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAAAATACT............GGATATTCATACTTCAAAGATTCACTGAAG...AACAAGTTCAGT
ATCGACTTAGACACTTCCAGCAAAACAGTGACTCTAACTGGACAGAACATGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGAGGT
>AY188782 |IGHV2S1*01_Anamin|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGGTTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
TCTCTGGATTTTCACTC............AGCAGCTACTATATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATTGCCTTGAATGATAACGGT......GGTAGCACCAAATACTACTCTCAGTCAGTCCAA...GGCCGGTTTACC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAACAGTCTGAAGACTGAAGATTCTGCTGTTTATTATT
GTGCTCGAGAT
>AY188786|IGHV2S2*01_Anamin|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGATTAAAAGGCCTGGAGAATC
ACACAGATTGATCTGTACAGCCTCTGGATTCACATTC............AGCAGCTACGGCATGCACTGGGTCAGACAG
GCTCCTGGAAAAGGACTGGAGTGGATCGCTTATATCAGCAGTGCT......AGTTCTTCTATCTACTACTCTCAGTCAG
TTCAA...GGCCAGTTTACCATCTCCAGAGACAACAACAGACAGCAGGTGTATCTGCAGATGAACAGTCTGAAGACGGA
AGATTCTGCTGTTTATTATTGTGCTCGATAT
>AY188787|IGHV2S3*01_Anamin|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGGTTAAAAGGCCTGGAGAATCACACAGGTTGACTTGTACAA
CATCTGGATTCACTCTT............AGTAGCTACTGGATGCACTGGGTCAGACAGGCTCCTGGCAAAGGACTGGA
GTGGGTTGCCGCTAATCATGGT............AGCACCAATCACTACTCTCAGTCAGTCCAA...GGCCGGTTTACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTATCTGCAGATGAGCAGTCTGAAGACAGAAGATTCTGCTGTTTATTATT
GTGCAGGGGTA
>AY188779|IGHV3S1*01_Anamin|(F)|V-REGION
GAGATCAAACTGGACCAG......TCTCCCTCT...GAGGTGAAAAGACCTGGAGAGACAGTGAAGATGTCATGTATCA
TATCTGGTTATAGCATG............ACAAGCTACAACATTCACTGGATACAACAGAGGCCAGGGAATGCTCTGGA
GTGGATTGGGTGGATGAACACAGGC......AGCAACTCTGCTAGCTATGGCAGCTCCTTTCAG...AGCCGTTTCATC
ATGACTGAAGATGAGCCCAGCAGCACTCAGTACCTCGAGGTCACGAGTCTGAGAGCAGAAGACTCTGCTGTTTACTTCT
GTGCTCGACAA
>J03616|IGHV1S1*01_Caraur|F|V-REGION
CAGGTGCAGCTGGTGGAG......TCCGGAGGG...GATGTGAAGAAGCCCGGAGACTCTCTGCGCCTCTCCTGCAAAG
CCTCCGGCTACACCTTC............AGCGGCTACACTATGTACTGGGTCCGCCAGGCCCCCGGGAAGGGGCTGGA
GTGGGTCTCACGTATTTACGATGAC......GGGAGTGATGTGTCCTACGCCGACACAGTGAAA...GGTCGATTCACC
ATCTCCAGGGATAATGCCAAGAACCTGCTTTATCTGCAAATGAGCAATTTGAAGCCTGAGGACACCGGCCGCTATTACT
GTGCGAGA
>X61312|IGHV2S1*01_Caraur|ORF|V-REGION
GGTCAGTCTTTGACCTCC......TCAGATTCT...GTGGTGAAAAAGCCTGGAGAATCAGTGACTCTGTCCTGCACTG
CTTCTGGATTCTCAATG............AGCAGCTACTGGATGGGCTGGATCCGTCAGAAACCAGGGAAAGCACTGGA
GTGGATTGGACAGATATCTGGC............TCAACTGTGTATTATGCTCAGTCTCTACAG...GGACAGTTCTCC
ATCACCACAGACACCAGCAAAAACATGCTGCATTTAGAGGTGAAGAGCCTGAAGACTGAAGACACAGCTGTTTATTACT
GTGCAAGAGACT
>X65266|IGHV2S2*01_Caraur|P|V-REGION
GTGGTCAGTCTTTGACCT......CCTCAGAGT...ATGCTGTGAAAAACTGGAAGAACAGTGATTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCAGTCACTGGATGCACTGGATCCGCCAGTAACCAGGGAAAGGACTGGA
GTGGATTGGATGTATAGATACTGGC.........TCAAGTGTATATTATGCTCAGTCTCTAAAG...GGCAGGTTATCC
ATCACCAAAGACACCAGCAAAAACATGCTGTATTTAAAAGTGATTGACCTGAAGACTGAATACACAGCTGTTTATTACT
GTGCACGAGACT
>X61313|IGHV3S1*01_Caraur|P|V-REGION
CTGACTTGAGTTTAAAGA......TCTGAGTCA...GTCATCATCAAACCTGGGAACAATCATAAACTGACCTGTACCT
TCTCTGGGATTGATGTT............GGAGCTGCAGATATTTCATGGACAAGACAAGCTGAAGGAAAAGCGCTTGA
GTGGATCTCATATATTTCTGCTCCAAGT...GGCAGCAGCAAATATTACTTTAAAACTGTTGAA...GGACGATTCACC
ATCTCCAGAGACAAGAGTAAAATGCAGGTGTATCTGCACATGACAAATCTGCAGACTGAAGACACTGCCGTTTATTACT
GTGCTCGAAAAAA
>AF273897|IGHV1S1*01_Danrer|F|V-REGION
GGTCAGTCTTTGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGATTCTCAATG............AGCAGCTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACT
>AF273899|IGHV1S1*02_Danrer|(F)|V-REGION
..........TGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACACTGTCCTGCACTG
TGTCTGGATTCTCAAAG............AGGAGTTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACAC
>AF273880|IGHV1S2*01_Danrer|(F)|V-REGION
GGTCAGTCTTTGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCAGCTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATCGGGCGAATTGATGGTGGC.........ACTGGCACTAATTTTGCTCAGTCTTTACAA...GGCCAGTTCACC
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGAGAA
>AF273886|IGHV1S2*02_Danrer|(F)|V-REGION
GGTCAGTCTTTGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCAGCTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATCGGGCGATTGATGGTG..........GACCTGGCACTAATTTTGCTCAGTCTTTACAA...GGCCAGTTCACC
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGAGAA
>AF273889|IGHV1S2*03_Danrer|(F)|V-REGION
GGTCAGTCTTTGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCAGCTACTACACGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATCGGGCGAATTGATGGTGGC.........ACTGGCACTAATTTTGCTCAGTCTTTACAA...GGCCAGTTCACC
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGAGAA
>AF273891|IGHV1S2*04_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCAGCTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATCGGGCGAATTGATGGTGGC.........ACTGGAACTAATTTTGCTCAGTCTTTACAA...GGCCAGTTCACC
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGAGAC
>AF273902|IGHV1S2*05_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCACCTACTACATGCACTGGATCCGCCAGAAACCAAGGAAAGGACTGGA
GTGGATCGTGCGAATTGATGGTGGC.........ACTGGCACTAATTTTGCTCAGTCTTTACAA...GGCCAGTTCACC
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGAGACT
>AF273890|IGHV1S3*01_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGATTTTCAATG............AGCAGGTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGGTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACC
>AF273900|IGHV1S3*02_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGATTCTCAATG............AGCAGGTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATACATAGACACCGGC.........ACAACAGCATATTACGGTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGAGACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACA
>AF273901|IGHV1S3*03_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCATTG
TGTCTGGATTCTCAATG............AGCAGTTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACT
>AF273894|IGHV1S3*04_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGATTCTCAATG............AACAGGTATTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACA
>AF273893|IGHV1S3*05_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTACTGCACTG
TGTCTGGATTCTCAATG............AACAGGTATTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACA
>AF273892|IGHV1S4*01_Danrer|(F)|V-REGION
..........TGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGTAGCTGGTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGGCTGAAGAGTGAAGACAC
>AF273896|IGHV1S4*02_Danrer|(F)|V-REGION
..........TGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGTAGCTGGTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACAC
>AF273879|IGHV2S1*01_Danrer|(F)|V-REGION
GAAATTCGATTAGATCAG......TCACCTTCT...GTGACAAAGAGACCTGGAGAAACGGTGATGATCTCCTGTAAAA
TATCTGGGTTTACAATG............ACACGCTACTACATGCACTGGATACGGCAGAAGCCTGGAAAAGCTCTGGA
GTGGATTGGGAGAGTTAACTCTGGC......TCTGGTAGTGCTGATTATGCAGATTCCATGAAA...AACCAATTCACT
CTGAGTGAGGACGTGTCTCAAAATATGCAATATCTTGAAGCCAAGAGTCTGAGAGAAGAGGACACTGCTGTTTATTACT
GTGCTCGGGGA
>AF273887|IGHV2S1*02_Danrer|(F)|V-REGION
GAAATTCGATTAGATCAG......TCACCTTCT...GTGACAAAGAGACCTGGAGAAACGGTGATGATCTCCTGTAAAA
TATCTGGGTTTACAATG............ACACGCTACTACATGCACTGGATACGGCAGAAGCCTGGAAAAGCTCTGGA
GTGGATTGGGAGAGTTAACTCTGGC......TCTGGTAGTACTGATTATGCAGATTCCATGAAA...AACCAATTCACT
CTGAGTGAGGACGTGTCTCAAAATATGCAATATCTTGAAGCCAAGAGACTGAGAGAAGAGGACACTGCTGTTTATTACT
GTGCTCGGGAG
>AF273883|IGHV3S1*01_Danrer|(F)|V-REGION
TGTCAAACACTGACCGAG......TCTGAAGCG...GCGGTCATTAAACATGGAGAATCTCACAGACTTACCTGTACAG
TCTCTGGATTCAGTGAT...............GATCCGTATTTGGCTTGGATCAGACAGACTGCAGGAGGAGGTCTGGA
GTGGCTGGCGTACATCTCAAGTAGT......GGTAGTACTACATACTACTCTCAGTCAGTTCAG...GGACGCTTCACC
ATCTCCAGAGACGACAGCAAGAAACAGATGTATCTGCAGATGAATAATATGAAGAGTGAAGACACTGCTGTATATTATT
GTGCAAGA
>AF273876|IGHV4S1*01_Danrer|(F)|V-REGION
CAAAGTATGGAGTCGATT......GAAAGCTCA...GTGCAGAGAAAGCCTGGAGAAACTCTGACTCTGTCCTGCAGAG
GATCCGGGTTCAGCTTT............AGCTCCTATTACATGCACTGGATCAGGCAACAAGCTGGAAAACCTCTTGT
GTGGATTGGAGGCACTGGC.....................TATGGCTATGTTGAATCCTTTAAA...GGAAGAGGTGAA
ATCACCAGAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGTCTGACAGTAGAAGATTCAGCCGTGTATTACT
GTGCAAGACAA
>AF273884|IGHV4S1*02_Danrer|(F)|V-REGION
CAAAGTATGGAGTCGATT......GAAAGCTCA...GTGCAGAGAAAGCCTGGAGAAACTCTGACTCTGTCCTGCAGAG
GATCCGGGTTCAGCTTT............AGCTCCTATTACATGCACTGGATCAGGCAACAAGCTGGAAAACCTCTTGT
GTGGATTGGAGGCACTGGC.....................TATGGCTATGTTGAATCCTTTAAA...GGAAGAGGTGAA
ATCTCCAGAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGTCTGACAGTAGAAGATTCAGCCGTGTATTACT
GTGCAAGACAA
>AF273877|IGHV4S1*03_Danrer|(F)|V-REGION
CAAAGTATGGAGTCGATT......GAAAGCTCA...GTGCAGAGAAAGCCTGGAGAAACTCTGACTCTGTCCTGCAGAG
GATCCGGGTTCAGCTTT............AGTTCCTATTACATGCACTGGATCAGGCAACAAGCTGGAAAACCTCTTGT
GTGGATTGGAGGCACTGGC.....................TATGGCTATGCTGAATCCTTTAAA...GGAAGAGCTGAA
ATCACCAGAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGTCTGACAGTAGAAGATTCAGCCGTGTATTACT
GTGCAAGACAA
>AF273882|IGHV4S2*01_Danrer|(F)|V-REGION
CAAAGTATGGAGTCAATT......GAAAGCTTA...GTTCAGAAGAAGCCTGGAGAAACTCTGACTCTGTCCTGTAGAG
GATCTGGGTTCACCTTT............AGCTCCTATAGCATGCACTGGATCAGACAACAAGCTGGAAAACCTCTTGT
GTGGATTGGATACACTGGC.....................CAAAACTATGCTGAATCCTTCAAA...GGAAGAGCTGAA
ATCACCAGAGATGATTCAAAGAGTATGACATATCTGAAACTATCAGGCCTGACAGCAGAAGACTCAGCCGTGTATTACT
GTGCAAGAGAA
>AF273885|IGHV4S2*02_Danrer|(F)|V-REGION
CAAAGTATGGAGTCGATT......GAAAGCTTA...GTTCAGAAGAAGCCTGGAGAAACTCTGACTCTGTCCTGTAGAG
GATCTGGGTTCACCTTT............AGCTCCTATAGCATGCACTGGATCAGACAACAAGCTGGAAAACCTCTTGT
GTGGATTGGATACACTGGC.....................CAAAACTATGCTGAATCCTTCAAA...GGAAGAGCTGAA
ATCACCAGAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGCCTGACAGCAGAAGACTCAGCCGTGTATTACT
GTGCAAGAGAA
>AF273878|IGHV4S3*01_Danrer|(F)|V-REGION
CAAGGCATGGAGTCAATT......GAAAGCTCA...GTTCAGAAAAAGCCTGGAGAAACTCTGACTCTGTCCTGTAGAA
GATCCGGGTTCACCTTT............AGCTACTATCACATGCACTGGATCAGACAACAAGCTGGAAAACCTCTTGT
ATGGATTGGACACACTGGC.....................CAAAACTATGCTGAATCCTTCAAA...GGAAGAGCTGAA
ATCACCAAAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGCCTGACACCAGAAGATTCAGCCGTGTATTACT
GTGCAAGAGTA
>M26182|IGHV1S1*01_Elosau|(F)|V-REGION
AGCCAGACACTGACTGAG......TCTGAACCA...GCAGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGCACAG
CCTCTGGGTTCACATTC............AGTAATTATTGGATGGGCTGGATCAGACAGGCTCCTGGGAAGGGACTGGA
GTGGTTGGCAACTCTGAAATATAAC......AGTGCTGAGGAGTATTACTCCCAATCTGTCAAG...GGAAGATTCACC
ATCTCCAGAGACAACAGCAAGAACCAGCTGTATTTACAGATGAACAGTCTAAGAGCTGAAGACACTGCTGTGTATTACT
GTGCCAGA
>M26579|IGHV2S1*01_Elosau|(F)|V-REGION
TGTGTTGAACTCACCCAG......CCAGGTTCT...ATGGCTGTAAAGCCAGGAGAGTCTCTGACCATCTCCTGTAAAG
TCTCTGGTTATTCCCTGACT......GATAGTACCTACTGTACAAACTGGATACGACAGCCTGTGGGGAAAGCATTAGA
ATGGATTGGACGTATTTGTGGCAGT.........GGAAACACTTACTACAAAGATTCTCTTAAG...AACAAATTCACC
ATCTCCAGAGACACCTCCAGCAGCACAGTGAAATTACAAGGACGCAGCCTGCAGACTGAAGACACAGCTGTGTATTACT
GTGCCCGAG
>X58870|IGHV1S1*01_Gadmor|(F)|V-REGION
AGCTTGGAACTTTCCCAG......CCTGTCGCT...GTCGTTGTGAGAACGACAGAGCCATTGGTCCTTACCTGTAAAG
TAACAGGATATTCTGTCAGTAGTGGTAGTGTAGACTACGCCACAAGTTGGATCAGACATCCAAAAGGACAACCACTGGA
GTGGATTTCCCATATCTGGGACAAC.........GGAGATATCTATAAAAACAATGCGCTGTCT...AGCAAGTTCACA
ATTTCTCGTGACTCAACTAGTAACTCAGTTTCTTTAAGAGGCCAGAATTTGCAGGAGAGTGATACAGCTGTGTATTACT
GTGCTCGC
>AJ279353|IGHV1S1*02_Gadmor|(F)|V-REGION
AGCTTGGAACTTTCCCAG......CCTGTCGCT...GTCGTTGTGAGAACGACAGAGCCATTGGTCCTTACCTGTAAAG
TAACAGGATATTCTGTCAGTAGTGGTAGTGTAGACTACGCCACAGGTTGGATCAGACATCCAAAAGGAAAACCACTGGA
GTGGATTTCCCATATCTGGGACAAC.........GGAGATATCTATAAAAACAATGCGCTGTCT...AGCAAGTTCACA
ATTTCTCGTGACTCAACTAGTAACTCAGTTTCTTTAAGAGGCCAGAATTTGCAGGACAGTGATACAGCTGTGTATTACT
GTGCTCGC
>AJ274705|IGHV1S1*03_Gadmor|(F)|V-REGION
AGCTTGGAACTTTCCCAG......CCTGTCGCT...GTCGTTGTGAGAACGACAGAGCCATTGGTCCTTACCTGTAAAG
TAACAGGATATTCTGTCAGTAGTGGTAGTGTAGACTACGCCACAGGTTGGATCAGACATCCAAAAGGAAAACCACTGGA
GTGGATTTCCCATATCTGGGACAAC.........GGAGATATCTATAAAAACAATGCGCTGTCT...AGCAAGTTCACA
ATTTCTCGTGACTCGACTAGTAACTCAGTTTCTTTAAGAGGCCAGAATTTGCAGGAGAGTGATACAGCTGTGTATTACT
GCGCCAGG
>AJ279354|IGHV1S2*01_Gadmor|(F)|V-REGION
AGCTTGGAACTTTCCCAG......CCTGTCGCT...GTCGTTGTGAGAACGACAGAGCCATTGGTCCTTACCTGTAAAG
TAACAGGATATTCTGTCAGTAGTGGTAATGCAGACTACGCCACAGGTTGGATCAGACATCCAAAAGGAAAACCACTGGA
GTGGATTTCCCATATCTGGGACGAC.........GGAGATATCTTTAAAAACAATGCGCTGTCT...AACAAGTTCACA
ATTTCTCGTGACTCGACTAGTAACTCAGTTTCTTTAAGAGGCCAGAATTTGCAGGAGAGTGATACAGCTGTGTATTACT
GCGCCAGG
>X76510|IGHV2S1*01_Gadmor|(F)|V-REGION
GGCCAGCAACTCACCTCC......TCAGAATCG...GTGGTCAAAAGGCAAGGAGAACCGGTTACACTGTCCTGTCACG
TGACCGGAGTCTCC..................CTCACTTATCTTCACTGGATTCGCCAGAGGTCAGGACATGGCCTGGA
GTGGATTGGACGGATAGATGATGGA.........ACCGGAACAATTTTTGCAGCGTCTCTTCAA...GGGCAGTTCACC
ATCACCAAAGACAGCACCAGAGAGGAGGTTTACTTAAATGTGAAGAGTCTGAAGCCAGAGGACTCAGCTCTTTATTATT
GTGCTAAA
>AJ274709|IGHV2S1*02_Gadmor|(F)|V-REGION
GGCCAGCAACTCACCTCC......TCAGAATCG...GTGGTCAAAAGGCAAGGAGAACCGGTTACACTGTCCTGTCACG
TGACCGGAGTCTCC..................CTCACTTATCTTCACTGGATTCGCCAGAGGTCAGGACATGGCCTGGA
GTGGATTGGACGGATAGATGATGAA.........ACCGGAACAATTTTTGCAGCGTCTCTTCAA...GGGCAGTTCACC
ATCACCAAAGACAGCACCAGAGAGGAGGTTTACTTAAATGTGAAGAGTCTGAAGCCAGAGGACTCAGCTCTTTATTATT
GTGCTAAA
>AJ279362|IGHV2S2*01_Gadmor|(F)|V-REGION
GGCCAGCAACTCACCTCC......TCAGAATCG...GTGGTCAAAAGGCAAGGAGAACCGGTTACACTGTCCTGTCACG
TGACCGGAGTCTCT..................CTCACTTATCTTCACTGGATTCGCCAGAGGTCAGGACATGGCCTGGA
GTGGATTGGACGGATAGATAGTGGA.........ACCGGAACAACTTTTGCAGCGTCTCTTCAA...GGGCAGTTCACC
ATTACCAAAGACAGCACCAGAGAGGAGGTTTACTTAAATGTGAAGAGTCTGAAGCCAGAGGACTCAGCTCTTTATTATT
GTGCTAAA
>AJ279363|IGHV2S2*02_Gadmor|(F)|V-REGION
GGCCAGCAACTCACCTCC......TCAGAATCG...GTGGTCAAAAGGCAAGGAGAACCGGTTACACTGTCCTGTCACG
TGACCGGAGTCTCT..................CTCACTTATCTTCACTGGATTCGCCAGAGGTCAGGACATGACCTGGA
GTGGATTGGACGGATAGATAGTGGA.........ACCGGAACAACTTTTGCAGCGTCTCTTCAA...GGGCAGTTCACC
ATTACCAAAGACAGCACCAGAGAGGAGGTTTACTTAAATGTGAAGAGTCTGAAGCCAGAGGACTCAGCTCTTTATTATT
GTGCTAAA
>AJ274715|IGHV3S1*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCAGTATACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCGATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGACAGCAACACAGCTATTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274742|IGHV3S1*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCAGTATACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCGATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGACAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274722|IGHV3S2*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCTCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCTATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGGCTCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCGGTGTATTACT
GTGCCAGG
>AJ274729|IGHV3S2*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCTCTGTCGGG
TCTCTTATTCTGTTAGT...............AGCCACTATACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCGATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACAAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ279366|IGHV3S3*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACTATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............ACCTACTACACACATTGGATAAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCAATGAA........................GGACATCTGAAAGACTCCCTAAGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGTAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ279365|IGHV3S3*02_Gadmor|(F)|V-REGION
...............................................................ACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............GGCGACTATACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCAATGAA........................GGACATCTGAAAGACTCCCTAAGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGTAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ279368|IGHV3S4*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGCGACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCGATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279369|IGHV3S4*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGTTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGCGACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCGATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGTCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ279367|IGHV3S4*03_Gadmor|(F)|V-REGION
AGTGAACAGCTTACTCAA......CCCGAGTCT...CTGACTATCCGACCTGGTCAGTCTCTGACCATCCACTGTCAGG
TCTCTTATTCTGTTAGT...............ACCTTCGCCACAGCTTGGTTCAGACAACCTGATGGAAACGGACTGGA
ATGGATAGGCGATGAA........................GAAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGC
>AJ274745|IGHV3S5*01_Gadmor|(F)|V-REGION
AGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTCTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGTAGC.........ACTGGCTACGCGACACATTGGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTAGGATT............GGTTGGAAAGGAGCGAAAGACTCCCTAAGT...AGTCAATTCAGT
CTTGCCGTTGATGGCTCCAGTAAAACAATTACTTTGCAAGGGCAGAACATGCAGCCTAGAGACTCAGCTGTGTATTTCT
GTGCCAGAG
>AJ274755|IGHV3S5*02_Gadmor|(F)|V-REGION
..................................................CGCTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGTAGC.........ACTGGCTACGCGACACATTGGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTAGGATT............GGTTGGAAAGGAGCGAAAGACTCCCTAAGT...AGTCAATTCAGT
CTTGCCGTTGATGGCTCCAGTAAAACAATTACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCCGG
>AJ274726|IGHV3S5*03_Gadmor|(F)|V-REGION
AGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTCTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGTAGC.........ACTGGCTACGCGACACATTGGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTAGGATT............GGTTGGAAAGGAGCGAAAGACTCCCTAAGT...AGTCAATTCAGT
CTTGCCGTTGATGGCTCCAGTAAAACAATTACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274718|IGHV3S6*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTCTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGAGACACATTGGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTAGGATT............GGTTGGAAAGGAGCGAAAGACTCCCTAAGT...AGTCAATTCAGT
CTTGCCGTTGACAGCTCCGTTAACACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGTGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274736|IGHV3S6*02_Gadmor|(F)|V-REGION
AGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTCTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGAGACACATTGGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTAGGATT............GGTTGGAAAGGAGCGAAAGACTCCCTAAGT...AGTCAATTCAGT
CTTGCCGTTGACAGCTCCGGTAACACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGTGACTCAGCTGTGTATTACT
GTGCCAGC
>AJ274748|IGHV3S7*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCTCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACAGCACGCATTTGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTCATACT............GGTTGGAAAGGACTGAAAGGCTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279370|IGHV3S8*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCTCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACAGCACACATTGGATAAGACAACCTGATGGAAAGGGACTGGA
ATGGATTGGAGGGATTAATACT............GGTTGGAAAGGAGCAAAAGACTCCCTAAGT...AGTAAATTCAGT
CTTTCCCTTGACGTGGCCAGTAAAACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274750|IGHV3S9*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTTTTCTGTTAGT...............AGCTACGCGACAGCTTGGATCAGACAACCTGATGGAAAAGGACTGGA
ATGGATTGGATGGATTTATACC............AGTGACAAAAAAGTGAAAGACTCCTTTAAT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAATAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCGAA
>AJ274719|IGHV3S9*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTTGACAGCTTGGATCAGACAACCTGATGGAAAAGGACTGGA
ATGGATTGGATGGATTTATACC............GCGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGGCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCGGG
>AJ274731|IGHV3S9*03_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTTGACAGCTTGGATCAGACAACCTGATGGAAAAGGACTGGA
ATGGATTGGATGGATTTATACC............GCGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AJ279371|IGHV3S9*04_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTTGACAGCTTGGATCAGACAACCTGATGGAAAAGGACTGGA
ATGGATTGGATGGATTTATACC............GCGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274721|IGHV3S10*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTATTGGACACATTGGATCAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATTCATTTATACC............AGTGACAAAAAAGTGAAAGACTCCCTTACT...AGTAAACTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274730|IGHV3S10*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTATTGGACACATTGGATCAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATTCATTTATACC............AGTGACAAAAAAGTGAAAGACTCCCTTACT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274737|IGHV3S11*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTATCCAACCTGGTCAACCTCTGACCATCCGCTGCCAGG
TCTCCTATACACTT..................AACTACTGGACACATTGGATCAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATTCATTTATACC............GGGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCGGA
>AJ279375|IGHV3S11*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTATCCAACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCCTATACACTT..................AACTACTGGACACATTGGATCAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATTCATTTATACC............GGGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274756|IGHV3S11*03_Gadmor|(F)|V-REGION
......................................................................TCTGCGGCC
GCTCCTATACACTT..................AACTACTGGACACATTGGATCAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATTCATTTCTACC............GGGAACAAAAAAGTGAAAGACTCCCTTAGC...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGAGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274741|IGHV3S12*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCTGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGAGACACATTGGATAAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATGGATTGATACC............GGGGACCAACACCTGAAAGACTCTCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAAAACAGTAACTTTGCAAGGGCAAAGCATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279385|IGHV3S12*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCTGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGAGACACATTGGATAAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATGGATTGATACC............GGGGACCAACACCTGAAAGACTCTCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAAAACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279378|IGHV3S13*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGAGACACATTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGATGGATTGATACC............GGGGACAAAAGAGTGAAAGATTCCCTTGGT...AGTAAATTCAGT
CTTTCCCTTGATGAGGCCAGTAAAACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274754|IGHV3S14*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAA......CCCGAGTCT...CTGACTGTCCGACCTGGCCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............GGCCACTACACAGCTTGGATCAGACAACCCGAAGGACAGGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTCGCAAGGGCAAAACATGCAGCCTGGAGACTCAACTGTGTATTACT
GTGCTAGG
>AJ274740|IGHV3S15*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAA......CCCGAGTCT...CTGACTGTCCGACCTGGCCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACAGGCACTGGA
ATGGATTGGCATGTTAGTTACT............GGGACCAAATACCAGAAAGACTCCCTTAGC...AGTAAATTCAGC
CTTTCCCTTGACGAGGCCAGTAAAACAGTAACTTTGCAAGGGCAGAACATGCAGGCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279376|IGHV3S15*02_Gadmor|(F)|V-REGION
AGTGAACAGCTTACTCAA......CCCGAGTCT...CTGACTGTCCGACCTGGCCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACAGCTTGGATCAGACAACCTGAAGGACAGGCACTGGA
ATGGATTGGCATGTTAGTTACT............GGGACCAAATACCAGAAAGACTCCCTTAGC...AGTAAATTCAGC
CTTTCCCTTGACGAGGCCAGTAAAACAGTAACTTTGCAAGGGCAGAACATGCAGGCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279377|IGHV3S16*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTGGACAGCTTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGAATGATTTATACT............GGGAACAAATTAATGAAAGACTCCCTGAGT...AGTAAATTCAGT
CTTTCCCTTGATGAGGCCAGTAAAACAGTAACTTTGCAAGGGCAGAACATGCAGGCTGGAGACTCAGCTGTGTATTACT
GTGCAGAA
>AJ279380|IGHV3S17*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTATCCGACCCGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTT..................GGTAGCTGGACAGCTTGGATAAGACAACCTGAAGGACACGCACTGGA
ATGGATTAGCATGATAAATACT............GGGGGCAAACACCAGAAAGACTCTCTTAGT...AGTAAATTCAGT
CTCACCCTTGACGTGGCCAGTAAAACAATTACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCGGT
>AJ279381|IGHV3S17*02_Gadmor|(F)|V-REGION
TGTGAACACGTTACTCAG......CCAGAGTCT...CTGACTATTCGCACCGGTCAACCTCTGACCATCCGTTGTCAGG
TCTCTTATTCTGTT..................GGTAGCTGGACAGCTTGGATAAGACAACCTGAAGGACACGCACTGGA
ATGGATTAGCATGATAAATACT............GGGGGCAAACACCAGAAAGACTCTCTTAGT...AGTAAATTCAGT
CTCACCCTTGACGTGGCCAGTAAAACAATTACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCGTT
>X76508|IGHV3S18*01_Gadmor|(F)|V-REGION
ACACAACAGCTTACTCAG......CCAGAGTCT...CTGATTGTCCGACCTGGTCAATCTCTGAACATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACGCAATGGATAAGACAACCTGATGGAAACCCACTGGA
ATGGATTGGTTATATTCGTGCC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGAGGCCAGTAAAACAGTAACTTTGCAAGGCCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCAGA
>AJ279382|IGHV3S18*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGATTGTCCGACCTGGTCAATCTCTGAACATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACGCAATGGATAAGACAACCTGATGGAAACCCACTGGA
ATGGATTGGTTATATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGAGGCCAGTAAAACAGTAACTTTGCAAGGCCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCAGA
>X76509|IGHV3S19*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTCTT..................AATTATTGGACAGCTTGGATCAGGCAACCTGAAGGACATGCACTGGA
ATGGATTGGACATATTGATTCT............TCGAGCAAAAGAGTGAAAGACTCTCTTGGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTTATTCTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>X76515|IGHV3S19*02_Gadmor|(F)|V-REGION
................................................CCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTCTT..................GTTTACTGGACAGCTTGGATCAGAAAACCTGAAGGACACGCACTGGA
ATGGATTGGACGTATTGATTCT............TCAAACAAAAATGTGAAAGACTCTCTTGGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTTATTCTGCAAGGACAAAACATGCAGCCTGTAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274749|IGHV3S19*03_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTCTT..................AGTTATTGGACAGCTTGGATCAGGCAACCTGAAGGACACGCACTGGA
ATGGATTGGACATATTGATTCT............TCAAGCAAAAGAGTGAAAGACTCTCTTGGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTTCTTCTGCAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>X76513|IGHV3S20*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTATCCAACCTGGTCAACTACTGACCATCCACTGTCAGG
TCTCTTATTCAGTTAGT...............ACCTACGGGACACATTGGATAAGACAACCTGAAGGACACGCTTTGGA
ATGGATTGGATGGATTTATACT............GGGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGGCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279386|IGHV3S21*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACAATTCAACCTGGTCAACTTCTGACCATCCGCTGTCAGG
TCTTTTATTCTGTTAGT...............ACCTACGCGACACATTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATATATTTATACC............GGGGGCAAAAGAGTGAAAGACTCCCTCAGT...AGTAAATTCAGT
CTTGCCGTTGACAGCTCCACTAAAACAGTAACTTTGCAAGGGCAAAACATGCAGCTTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279387|IGHV3S21*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACAATTCAACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............ACCTACGCGACACATTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATATATTTATACC............GGGGGCAAAAGAGTGAAAGACTCCCTCAGT...AGTAAATTCAGT
CTTGCCGTTGACAGCTCCACTAAAATAGTAACTTTGCAAGGGCAAAACATGCAGCTTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ279389|IGHV3S22*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTGGACAGCTTGGGTCAGACAACCTGAAGGACATGGACTGGA
ATGGATTGGATGGATTTATACT............GGGGGCAAACACCAGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGTCGTTGATGGCTCCAGTAACACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCGGA
>AJ279391|IGHV3S23*01_Gadmor|(F)|V-REGION
..........................................GTCCGACCTGGTCAACCTCTTACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTCCTGGACACATTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGAAGGATTTATACC............GGGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTGTCGTTGACGACTCCAGTAGTACAGTAACTTTGCAAGGGCAGAACATGCACCCTGGAGACTCAGCGGTGTATTACT
GTGCCGGC
>AJ274735|IGHV3S24*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACACATTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGACGGATTGTTCCT............GGGGGCAAAACAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGACGTTGACGGCTCCAGTAACACAGTAACCCTGCAAGGGCAGAACCTGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCGGG
>AJ279392|IGHV3S24*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACACATTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGACGGATTGTTCCT............GGGGGCAAAACAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGTCGTTGACGGCTCCAGTAACACAGTAACCCTGCAAGGGCAGAACCTGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCAGA
>AJ274751|IGHV3S25*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCAACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACAGCTTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGGCAAAACAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACCCTGCAAGGGCAGAACCTGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCAGA
>AJ274728|IGHV3S26*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAAT...............AGCTACTACACAGCTTGGATCAGACAACCTGAAGGACGCGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGGCAAAAGAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGTCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACCTGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCAGA
>X76507|IGHV3S27*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCGGAGTTT...CTTACTATCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TTTCTTATTCTGTTAGT...............AGCTACTACACAGCTTGGATCAGACAACCTGAGGGACATGCACTGGA
ATGGATTGGCATGATAAAGACT............GGGGACAAACACCAGAAAGACTCTCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAAAACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGATAGAA
>AJ279393|IGHV3S27*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGATGGATTGTTACC............GGGGACAAAAGAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACCTGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279394|IGHV3S28*01_Gadmor|(F)|V-REGION
TGTTTACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATGCTGTTAGT...............GGCCACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTCGA
ATGGATTGGACGGATTTATACT............GGGGACAAACTAATGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGCTGTTGACGGCTCCAGTAATACATTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGC
>AJ274744|IGHV3S28*02_Gadmor|(F)|V-REGION
TGTTTACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATGCTGTTAGT...............GGCCACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTCGA
ATGGATCGGACAGATTTATACT............GGGGACAAACTAATGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGCTGTTGACGGCTCCAGTAATACATTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>X76512|IGHV3S29*01_Gadmor|(F)|V-REGION
TGTGAACAACTTACTCAG......CCAGGGTCT...CTGACCGTCCGACTTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGAGAAAAAAGTGAAAGACACCCTAAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>X76514|IGHV3S29*02_Gadmor|(F)|V-REGION
.................A......GCAGGGTCT...CTGGCTGTCCGACTTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATGCTGTTAGT...............GGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGAGAAAAAAGTGAAAGACACCCTAAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>X76511|IGHV3S29*03_Gadmor|(F)|V-REGION
TGTGAACAACTTACTCAG......CCAGGGTCT...CTGGCTGTCCGACTTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATGCTGTTAGT...............GGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGAGAAAAAAGTGAAAGACACCCTAAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGT
>AJ274724|IGHV3S30*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCACTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGACAAAAAAGTGAAAGACACCCTAAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACCTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274723|IGHV3S31*01_Gadmor|(F)|V-REGION
TGTGAACGGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCACTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATCGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274725|IGHV3S31*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCACTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279395|IGHV3S32*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274746|IGHV3S32*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATTCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACC
GTGTTGCG
>AJ274753|IGHV3S32*03_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGTCACGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274720|IGHV3S32*04_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAGAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274743|IGHV3S32*05_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGC...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAATAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274717|IGHV3S33*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGACTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGC
>AJ274716|IGHV3S34*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTAAGT...............AGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGATGGATTCATACC............GGGGGCAAAAGAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTCACCCTTGACGAGGCCAGTAAAACAATTACTTTGCAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274711|IGHV4S1*01_Gadmor|(F)|V-REGION
GCTCAGACAATAACACAA......TCTGAACCA...GTTGTTGCAGAGCTGATGGAATCACATACATTGACATGCACAT
ATTCTGGACTACCAACT...............AGTAGTGCATTTGCCTGGATCAGGCAGAACGAAGAGAAGGGACTGGA
ATGGATTGCATATATAACAGGACCTAGT...GGGGGCACCAAGTCCTACTCTGTGTCGGTCAAG...GGCCGCTTCACC
ATCTCAAGGGACAATGACAACCAGCAAGTACATCTCCAGATGGACCAGCTGGAGACTGCGGACTCCGCTGTCTATTATT
GTGCTAGA
>AJ274712|IGHV4S1*02_Gadmor|(F)|V-REGION
GCTCAGACAATAACACAA......TCTGAACCA...GTTGTTGCAAAGCTGATGGAATCACATACATTGACATGCACAT
ATTCTGGACTACCAACT...............AGTAGTGCATTTGCCTGGATCAGGCAGAACGAAGAGAAGGGACTGGA
ATGGATTGCATATATAACAGGACCTAGT...GGGGGCACCAAGTCCTACTCTGTGTCGGTCAAG...GGCCGCTTCACC
ATCTCAAGGGACAATGACAACCAGCAAGTACATCTCCAGATGGACCAGCTGGAGACTGCGGACTCCGCTGTCTATTATT
GTGCTAGA
>AJ274713|IGHV4S1*03_Gadmor|(F)|V-REGION
GCTCAGACAATAACACAA......TCTGAACCA...GTTGTTGCAAAGCTGATGGAATCACATACATTGACATGCACAT
ATTCTGGACTACCAACT...............AGCAGTGCATTTGCCTGGATCAGGCAGAACGAAGAGAAGGGACTGGA
ATGGATTGCATATATAACAGGACCTAGT...GGGGGCACCAAGTCCTACTCTGTGTCGGTCAAG...GGCCGCTTCACC
ATCTCAAGGGACAATGACAACCAGCAAGTACATCTCCAGATGGACCAGCTGGAGACTGCGGACTCCGCTGTCTATTATT
GTGCTAGA
>U09719|IGHV1S1*01_Ictpun|F|V-REGION
GGACAGTCCCTGACCTCC......TCTGCTTCT...GTGGTGAAGAGACCTGGAGAGTCAGTCACTCTGTCCTGTACTG
TCTCCGGATTCTCAGTG............GGCAGCTACTACATGCACTGGATCCGTCAGAAACCTGGAAAAGGATTGGA
GTGGATCGGGCGCATTGACAGTGGC.........ACTGGCACAACATTCGATCAATCTCTGCAG...GGCCAGTTCTCC
ATCACTAAAGACACCAATAAAAACATGCTGTACCTAGAAGTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGACACT
>AF068137|IGHV1S2*01_Ictpun|F|V-REGION
GGACAGTCCCTGACCTCC......TCGGCTTCT...GTGGTGAAGAGACCTGGTGAGTCAGTCACTCTGTCCTGTACTG
TCTCCGGATTCTCAGTG............GGCAGCAACTGGATGAGCTGGATCCGTCAGAAACCAGGAAGAGGACTGGA
GTGGATTGGATACATTGACACTGGC.........ACTGGCACTGGCTTTGCCCAGTCTCTGCAG...GGCCAGTTTTCC
ATCACTAAAGACACCAATAAAAACATGCTGTACCTAGAAGTGAAAAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGAGACT
>AF068137|IGHV1S3*01_Ictpun|(F)|V-REGION
GGACAGTCCCTGACCTCC......TCTGCTTCT...GTGGTGAAGAGGCCTGGAGAGTCAGTCACTCTGTCCTGTACTG
TCTCCGGATTCTCAATG...............AGCAGCTACATCCACTGGATCCGTCAGAAACCAGGAAAAGGATTGGA
GTGGATCGGATACATTGACACTGCC.........ACTGGCACAACATTCGCTCAGTCTCTGCAG...GGCCAGTTCTCC
ATCACTAAAGACACCAATAAAAACATGCTGTACTTAGAAGTGAAGAGTCTGAAAGCTGAAGACACGACTGTTTATTACT
GTGCAGGAGAC
>M27230|IGHV1S4*01_Ictpun|(F)|V-REGION
GGACAGTCCCTGACCTCC......TCGGCTTCT...GTGGTGAAGAGACCTGGTGAGTCAGTCACTCTGTCCTGTACTG
TTTCCGGATTCTCAGTG............GGCAGCAACTGGATGAGCTGGATCCGTCAGAAATCAGGAAGAGGACTGGA
CTGGATTGGATACATTGACACTGGC.........ACTGGCACTGGCTTTGCCCAGTCTCTGCAG...GGCCAGTTTTTC
ATCACTAAAGACACCAATAAAAACATGCTGTACCTAGAAGTGAAAAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGGGTC
>M58673|IGHV1S5*01_Ictpun|(F)|V-REGION
GGACAGTCCCTGACCTCT......CTTGGTTCT...GTGGTGAAGAGACCTGGAGAGTCAGTCACTCTCTCCTGTACTC
TCTCCGGATTCTCATTG............GACAGCTACTGGATGAGTTGGATCCGTCAGAAACCAGGCAAGGGATTGGA
GTGGATCGGGCGCATTGACAGTGGC.........ACTGGCACAACATTCACTCAGTCTCTGCAG...GGCCAATTCTCC
ATCACTAAAGACACCAATAAAAACATGCTGTACCTTGAAGTGAAGAGTCTGAAAACTGAAGACATGGCTGTTTATTACT
GTGCACGGTTA
>U67437|IGHV1S6*01_Ictpun|(F)|V-REGION
GGACAGTCCCTGACCTCC......TCTGCTTCT...GTGGTGAAGAGACCTGGAGAGTCAGTCACTCTGTCCTGTACTG
TCTCTGGATTCTCAATG............GGCAGCAACTACATGCACTGGATCCGTCAGAAACCTGGAAAAGGATTGGA
GTGGATCGGGCGCATTGACCGTGGC.........ACTGGCACAACATTCGCTCAGTCTCTGCAG...GGCCAGTTCTCC
ATCACTAAAGACACAAATAAAAACATGCTGTACCTAGAAGTGAAGAGTCTGAAAGCTCAAGAAACGGCTGTTTATTACT
GTGCAGGAGAA
>U67439|IGHV1S7*01_Ictpun|(F)|V-REGION
.....GTCCCTGACCTCC......TCTGCTTCT...GTGGTGAAGAGACCTGGAGAGTCAGTCACTCTGTCCTGTACTG
TCTCCGGATTCTCAATG............AGCAGCTACTGGATGAGCTGGATCCGTCAGAAACCACGAAGAGGACTGGA
ATGGATTGGATACATTAATTATGGC.........ACTGGCACTGGCTTCACTCAGTCTCTTCAG...GGCCAGTTCTCC
ATCACTAAAGACACCAATAAAAACATGCTGTACCTAGAAGTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGACAC
>AF161275|IGHV1S8*01_Ictpun|(F)|V-REGION
........................................................................TGTACTG
TCTCCGGATTCTCAATG............GGCAGCTACTACATGAGCTGGATCCGTCAGAAACCAGGAAGGGGACTGGA
GTGGATCGGATACGTTGACACTGGC.........ACTAGCACAACATTCGCTCAGTCTCTGCAG...GGCCAGTTCTCC
ATCGCTAAAGACACAAATAAAAACATGCTGTACCTAGAAGTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGGTTC
>AF161276|IGHV1S9*01_Ictpun|(F)|V-REGION
........................................................................TGTACTG
TCTCCGGATTCTCAATG............GCCGGCAACTTCATGCACTGGATCCGTCAGAAACCTGGAAAAGGATTGGA
GTGGATCGGGCGTATTGACAGTGGC.........ACTGTCACAACATTCGCTCAATCTCTGCAG...AGCCAGTTCTCC
ATCATTAAAGACACCGATAAAAACGTCCTCTACCTAGAATTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGGACGGCCA
>AF161278|IGHV1S10*01_Ictpun|(F)|V-REGION
........................................................................TGTACTG
TCTCCGGATTCTCAATG............GGCAGCTACTGGATGAGCTGGATCCGTCAGAAACCAGGAAGAGGACTGGA
GTGGATTGGATACATTGACACTGGC.........ACTCATACTGGCTTTGCCCAGTCTCTGCAG...GGCCAGTTTTCC
ATCACTAAAGACACCAATAAAAACATACTGTACCTTGAAGTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGAAAA
>AF161283|IGHV1S11*01_Ictpun|P|V-REGION
..............................................................................T
GCAACGTGTCCGGACTC............TCGCTTAGCTGGCTCCACTGGATCCGTCAGAAACCAGGAAAAGGACTGGA
GTGGATCGGGCGAATTGACAGTGGC.........ACCGGCACTATATTCGCTCAGTCTCTGCAG...GGCCAGTTCTCC
ATCACTAAAGATACCAATAAAAACATGGTGTACCTAGAAGTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCATGAGGA
>M58671|IGHV2S2*01_Ictpun|(F)|V-REGION
GGTGAGGAACTGACTCAG......CCTGCTTCC...ATGACAGTCCAGCCAAGCCAGAGTCTCTCCATCAACTGCAAGG
TTTCGTATTCAGTTACC...............AGCTATTATACAGCTTGGATCCGACAACCTGCAGGAAAAGCTCTGGA
GTGGATTGGATACATCAGTAACAAT.........GGGGGTACAGTTTACAGTGACAAACTGAAA...AATAAGTTCAGC
ATTTCCAGAGACACTGCTACTAACACAATAACAATTCGAGGACAGAATCTGCAAACTGAAGACACAGCTGTGTATTACT
GTGCAAGGGCTG
>M58670|IGHV2S3*01_Ictpun|(F)|V-REGION
GGAGAGGAACTGACTCAG......CCTGCTTCC...ATGACAGTCCAGCCAGGCCAGAGTCTCTCCATCAACTGCAAGG
TTTCATATTCAGTTACA...............AGCTATTATACAACTTGGATCCGACAACCTGCAGGAAAAACTCTGGA
GTGGATTGGATACATCAGTGGTGGT.........GGTAATACATATTACAGTGACAAACTGAAA...AATAAGTTCAGC
ATCTCCAGAGACACTGCTACTAACACAATAACAATTCGAGGACAGAATCTGCAAACTGAAGACATAGCTGTGTATTACT
GCGCAAGAGCGT
>M58675|IGHV2S4*01_Ictpun|(F)|V-REGION
GGTATTGAACTGACTCAG......CCTACTTCC...ATGACAGTCCAGCCAGGCCAGAGTCTCTCCATCAAGTGCAAGG
TTTCATATTCAGTTACC...............AGCGACCATACAGCTTGGATCCGACAACCTGCAGGAAAACCTCTGGA
GTGGATTGGAAACATCTATACCAGT.........GGGGGTACAGCTTACATTGACAAACTGAAA...AATAAGTTCAGC
ATATCCAGAGACACTGCTACTAACACAATAACAATTGGAGGACAGAATCTGCAAACTGAAGACACAGCTGTGTATTACT
GTGCAAGACTG
>U67441|IGHV2S5*01_Ictpun|(F)|V-REGION
GGTGTTGAACTGACTCAG......CCTGCTTCC...ATGACAGTCCAGCCAGGCCAGAGTCTCTCCATGAACTGCAAGG
TTTCATATTCAATTGCC...............ATCTATGATACAGCTTGGATCCGACAACCTGCAGGAAAAGCTCTGGA
GTGGATTGCATACATTCATGGCAGT.........GGGAGTATATCGTACAGTGACACACTGAAA...AATAAATTCACC
ATCTCCAGAGACACTACTACTAACACAATAACAATTGGGGGACAGAATCTGCAAACTGAAGACACGGCTGTGTATTACT
GCGCAAGATAT
>AF161279|IGHV2S6*01_Ictpun|(F)|V-REGION
...............................................................................
..TGCAAGGTTTCATATTCA......GTTACCAGCTGTTGTACAGCTTGGATCCGACAACCTGCAGGAAAAGCTCTGGA
GTGGATTGGAAACATCTATAGCGGT.........GGAAGTACAGTTTACAGTGACAAACTGAAA...AATAAGTTCAGC
ATCTCCAGAGACGCTGCTACTAACACAATAACAATTGGAGGACAGAATCTGCAAACTGAAGACACAGCTGTGTATTACT
GCGCAAGAGGG
>U09721|IGHV3S1*01_Ictpun|F|V-REGION
AGTCAGACTCTTATCGAG......TCTGATTCA...GTGATCATCAAACCTGATCAGTCTCATAAACTGACCTGCACAG
CTTCTGGATTGGACATT............AGTAGCTATTACATGGCTTGGATCAGACAGGCGCCTGGAAAAGGGCTGGA
ATTTGTTGCAACTAACCACGGC............AGTAACAAGTATTACTCCAGTGCAGTTAAT...GGCCGCTTCACC
ATCTCCAGAGATGACAGTAAGAAGCAGGTATATCTGCACATGACCAGCGTGAGGACAGAAGACACTGCAGTGTATTACT
GCGCCCGTGACC
>AF068137|IGHV3S2*01_Ictpun|F|V-REGION
AGTCAGACACTGATTGAG......TCCGATTCA...GTGATCATCAAACCTGATCAGTCTCACAAACTGACCTGCACAG
CTTCAGAATTTAAATTT............GGTGGCTCTAGGATGGCTTGGATCAGACGGGCACCTGGAAAAGGGCTGGA
ATTTGTTTGCACTATTTCAGACACC......AGTAATAGCATACATTACTCCAGTGCAGTTAAT...GGCCACTTCACC
ATCTCCAAAGACAACAGTAAGATGCAGGTGCATCTGCACATGAACGGCATGAGGACAGAAGACACTGCAGTGTATTACT
GCACTAGAGAAG
>M58672|IGHV3S3*01_Ictpun|(F)|V-REGION
AGTCAGACACTGATCGAG......TCCGATTCA...GTGATCATCAAACCTGATCAGTCTCATAAACTGACCTGCACAG
CGTCTGGATTTAACTTT............GGTGGCTCTTGGATGGCTTGGATCAGACAGTCACCTGGAAAAGGGCTGGA
ATGGGTTGCAACTATCTCAGACACC......AGTGGTAGCAAGTATTACTCCAGTGCAGTTAAT...GGCCGCTTCACC
ATCTCCAGAGACAACAGTAAGATGGAGGTGTATCTGCACATGGCCAGTGTGAGGACAGAAGACACTGCAGTGTATTACT
GCACTAAAGAC
>M58699|IGHV3S4*01_Ictpun|(F)|V-REGION
AGTCAGACTCTTATCGAG......TCTGATTCA...GTGATCATCAAACCTGATCAGTCTCATAAACTGACCTGCACAG
CTTCTGGATTGGACATT............AGTAGCTCGTGGATGGCTTGGATCAGACAGGCGCCTGGAAAAGGGCTGGA
ATTTGTTGCAATTATTGAGAATGAT......AGTGATAGGAAGTTTTACTCCAATGCAGTTAAT...GGCCGCTTCACC
ATGTCCAGAGACAACAGTAAGAAGCAGGTGTATCTGCAGATGAACAACGTGAGGACAGAAGACACTGCAGTGTATTACT
GCGCCCGTGAC
>U67442|IGHV3S5*01_Ictpun|(F)|V-REGION
.........................................TCATAAACCTGAACAGTCTCATAAACTGACCTGCACAG
CTTCTGGATTGGACAGT............AGTAGCTACTGGATGGCTTGGAGCCGACAGGCGCCTGGAAAAGGACTGGA
ATTTGTTGCAACTATCGAGTATGAT......AGTGATAGCACGTATGACTCCAGTGCAGTTAAT...GGCCGCTTCACC
ATCTCCAGAGACGACAGTAAGAAGCAGGTGTTTCTGCACATGAACAGCGTGAGGACAGAGGACACTGCAGTGTATTACT
GCGCCCGGGGC
>AF161272|IGHV3S6*01_Ictpun|(ORF)|V-REGION
...............................................................................
.....GGTGGC........................TACTGGATGGCTTGGATCAGACAGGCTCCTGGAAAAGGGCTGGA
ATTTGTTGCAGCAACCTACGATACC.........AGTAACATACGCTACTCTAGTGCAGTTAAT...GGCCGCTTCACC
ATCTCCAGAGACAACAGTAAGAAGCAGGTGTATCTGCAGATGAACAGTGTGAGGACAGAAGACACTGCAGTGTATTATC
GCGCCCGTGAC
>AF161273|IGHV3S7*01_Ictpun|(F)|V-REGION
........................................................................TGCACAG
CTTCTGGATTCGACTTT............AGTAGCTACTGGATGGCTTGGATCAGACAGGCGCCTGGAAAAGGACTGGA
ATTTGTTGCAACTGTCTACAGC............AGTAGCAAGTATTACTCCAGTGCAGTTAAT...GGCCGCTTCACC
AACTCCAGAGACGACAGTAAGAAGCAGGTATATCCGCACATGACCAGCGTGAGGACAGAAGACACTGCAGTGTATTACT
GCGCCCGTGGG
>AF161274|IGHV3S8*01_Ictpun|(F)|V-REGION
........................................................................TGCACAG
CCTCTGGATTGGACATT............AGTAGTTACTGGATGGCTTGGATCCGACAGGCGCCTGGAAAAGGGCTGGA
GTTTGTTGCAACTATCGAGTATGATAGT...GATAGCAAGTATTACTCCAGTGCAGTTAATGGC...CGCTTCACCATC
TCCAGAGGC...GGTAGTAAGAAGCAGGTGTATCTGCAGATGAACAGTGTGAGGACGGAAGACACTGCAGTGTATTACT
GCGCCCGGCGT
>AF161277|IGHV3S9*01_Ictpun|(F)|V-REGION
........................................................................TGCACAG
CGTCTGGATTTAACTTT............GGTGGCTCTTGGATGGCTTGGATCAGACAGGCGCCTGGAAAAGGGCTGGA
ATGGGTTGCAACTATCTCAGACACC......AGTGGTAGCAAGTATTACTCCAGTGCAGTTAAT...GGCCGCTTCACC
ATCTCCAGAGACAACAGTAAGATGCAGGTGTATCTGCACATGGCCAGTGTGAGGACAGAAGACACTGCAGTGTATTACT
GCACTAGAGCC
>U09722|IGHV4S1*01_Ictpun|F|V-REGION
GCAGTAGAACTCACTCAG......GTCACCTCA...GTGATGTTAAAGCCAGGAGATTCTTTAACCCTCAGCTGTAAAG
TATCCGGCTACTCTGTTACT......GATAACAGCTACGCCACAGCTTGGATTCGACAACCTGCAGGAAAAACTCTGGA
ATGGATAAACTACATTTGGGGTGGT.........GGAAGTAGTTATCATAAAGATTCTCTAAAA...AGCAAGTTCAGT
ATTTCTAAAGATGGCTCCAGCAGCACGGTGACTCTGAGAGGACAGAATCTGCAGACAGAAGACACAGCTGTGTATTACT
GCACCCGCCACA
>M58668|IGHV4S2*01_Ictpun|(F)|V-REGION
GCAGTAGAACTCACTCAG......GTCACCTCA...GTGATGTTAAAGTCAGGAGATTCTTTAACCCTCAACTGTAAAG
TATCCGGCTACTCTGTTACT......GATAACAACTACGCCACAGGTTGGATTCGACAACCTGCAGGAAAAACTCTGGA
ATGGATAAACTACATTTGGGGTGGT.........GGAAGTACTTATCATAAAGATTCTCTAAAA...AGCAAGTTCAGT
ATTTCTAAAGATGGCTCCAGCAGTACGGTGACTCTGAGAGGACAGAATCTGCAGACAGAAGACACAGCTGTGTATTACT
GCACCCGCCATC
>U67443|IGHV4S3*01_Ictpun|(F)|V-REGION
.......................................ATGTTAAAGTCAGGAGATTCTTTAACCCTCAACTGTAAAG
TATCCGGCTTCTCTGTTACT......GATAACAGCTACGCCACAGCTTGGATTCGACAACCTGCAGGAAAGCCTCTGGA
ATGGATAAATCACATTTGGGGTGGT.........GGAATTACTTATCATAAAGATTCTCTAAAA...AGCAAGTTCAGT
ATTTCTAAAGACGGGTCCAGCAGCACGGTGACTCTGAGAGGACAGAATCTGCAGACAGAAGACACAGCTGTGTATTGCT
GCACCGGAGGG
>AF161282|IGHV4S4*01_Ictpun|(F)|V-REGION
........................................................................TGTAAAG
TATCCGGCTACTCTGTTACT......GATAACACGTACGCCACAGCTTGGATTCGACAACCTGCAGGAAAAACTCTGGA
ATGGATAAATCACATTTGGGGTGGT.........GGAAGTACTTATCATAAAGATTCTCTAAAA...AGCAAGTTCAGT
ATTTCTAAAGACGGCTCCAGCAGCACGGTGACTCTGAGAGGACAGAATCTGCAGACAGAAGACACAGCTGTGTATTACT
GCACCCGCTACG
>M58674|IGHV5S2*01_Ictpun|(F)|V-REGION
GCTACTGAGCTCATCCAG......CCAGACTCA...GTGGTTATAAAGCCAGGAGAGACTTTAACCATCACCTGTAGAG
TGTCTGGAGCTTCTATCACTGATAGCAGCAGCCACTATGGAACAGCTTGGATTCGACAACCTGCAGGAAAATCTCTGGA
ATGGTTCAACAGCATTTATTATGAT.........GGGGGTATTAATAAGAAAGATTCACTTAAA...GACAAGTTTGTC
ATCTCTCGAGACACGTCCAGCAGCACAGTAATATTAACAGGGCAGGACATGCAGACTGAAGACACAGCTGTGTATTACT
GCGCTCGTGAA
>U67444|IGHV5S3*01_Ictpun|(F)|V-REGION
.............................................AAGCCAGGAGAGACTTTAACCATCACCTGTAGAG
TGTCTGGAGCTTCTATCACTGATAGCAGCAGCCACTATAGAACAGCTTGGATTCGACAACCTGCAGGAAAAGCTTTAGA
ATGGATCAACAGCATTGATTATGAT.........GGGGGTATTTATAAGAAAGATTCACTCAAA...GACAAGTTTGTT
GTCTCTCGAGACACTTCCAGTAACACTCTGACCTTACGGGGACAGAACATGCAGACTGAAGACACAGCTGTGTATTACT
GTCGTCGTGCG
>AF161281|IGHV5S4*01_Ictpun|(F)|V-REGION
........................................................................TGTAGAG
TGTCTGGAGCTTCTATCACTGATAGCAGCAGCCACTATGGAACAGCTTGGATTCGACAACCTGCAGGAAAATCTCTGGG
ATGGATCAACAGCATTTATTATGAT.........GGGGGGATTAATAAGAAAGATTCACTTAAA...GACAAGTTTGTC
ATCTCTCGAGACACATCCAGCAGCACAGTAATATTAACAGGGCAGAACATGCAGACTGAAGACACAGCTGTGTATTACT
GCGCTCGTAGA
>U09724|IGHV6S1*01_Ictpun|F|V-REGION
TGTGTTGAGCTGATCCAG......CCCGGATCC...ACACTCATAACCCCTGTTCAGTCAATGACTCTGACCTGCAAAG
TGTCTGGATATTCAGTAACT......GATAGCAGCTACTGTACAGACTGGATAAGACAACCTGCAGGAAAAGCTCTGGA
GTGGGTCGCAGGAGCATGTGGTGAT.........GGTAAAACCTACCACAGTGAGAAACTGAAA...AGCAGGTTTCAG
GTTTCCAGAGACACGTCCAACGGCACAGTAACACTAACAGGGCAGAACATGCAGACTGAAGACTCAGCTGTGTATTACT
GCGCTCGTGAAC
>M64400|IGHV6S2*01_Ictpun|(F)|V-REGION
TGTGTTGAGTTGATTCAA......CCTGGAGCA...ATGATTTTATCCCCGGGGCAGTCAATGACTCTGACCTGTAAAA
TGTCTGGATATTCAGGAAGT......GATGGCAACTACTGGACACACTGGATACGACAACCTGCAGGAAAAGCTCTGGA
GTATATCGGACAAATATCTGGTAGT.........GGTAGTACTTACTACAGTGAGAAACGGAAA...ACCAGGTTTCAG
GTTTCCAGAGACACGTCCAGCACCACAGTAACATTAACAGGGCAGAACATTCAGACTGAAGACACAGCTGTGTATTACT
GCGCTCGTGAAC
>U67445|IGHV6S3*01_Ictpun|(F)|V-REGION
.......................................ATTTTATCCCCGGGGCAGTCAATGACTCTGACCTGTAAAG
TGTCTGGATATTCATTAACT......GATAGCAACTACTGTACAAACTGGATACGACAACCTGCAGGAAAAGCTCTGGA
GTGGGTCGGACGGATATGTAGTAGC.........GGTAACACTTACTACAGCGAGAAACTGAAA...ACCAGGTTTCAG
GTTTCCAGAGACACGTCCAGCAGCACAGTAACATTAACAGGGCAGAACATGCAGACTGAAGACACAGCTGTGTATTACT
GCGCTCGGGGT
>AF161271|IGHV6S4*01_Ictpun|(F)|V-REGION
........................................................................TGTAAAG
TGTCTGGATATTCAGTAAGT......GATGGCAGCTACTGGACACACTGGATACGACAACCTGCAGGAAAAGCTCTGGA
GTGGGTCGCACAAATATCTGGTAGT.........GGTAGGACTTACTACAGTGAGAAACTGAAA...AGCAGGTTTCAG
GTTTCCAGAGACACGTCCAGCACCACAGTAACATTAACAGGGCAGAACATGCAGACTGAAGACACAGCTGTGTATTACT
GCGCTCGTGAA
>AF161280|IGHV6S5*01_Ictpun|(F)|V-REGION
........................................................................TGTAAAG
TGTCTGGATATTCATTAACT......GATAGCGACTGCTGTACACACCGGATACGACAACCTCCTGGAAAAGCTCTGGA
GTGGGTCGGACAGATATGTGGTAGC.........GGTTACACTTACTACAGTGAGAGACTAAAA...AGCAGATTTCAG
GTTTCCAGACACACGTCCAGCAGCACAGTAACATTAACAGGGCAGAACATGCAGACTGAAGATACAGCTGTGTATTACT
GCTCGCGCTCT
>U34411|IGHV7S2*01_Ictpun|(F)|V-REGION
GAGATCAGACTGGACCAG......TCTCCTGCT...GTGGTAAAGAGACCTGGAGAAACTGTGAAGATCTCGTGTAAAA
TAAGTGGATATTCAATG............ACAAGCTACAACATACACTGGATCCAACAGAAACCAGGGAAAGTTCTGGA
ATGGAGTGGCTGGATGAATACAGGC......AATAATAAAGGAACATATGCAGAGTCTGTGAAA...AACCGGCTTTTT
TTTTCAGAGGACGTCTCAGCAAGTACACAGTACTTAGAGGCCAAGAGTCTGAGGACAGAGGACACTTCGGTTTATTACT
GTGCCCGAACG
>U34410|IGHV7S3*01_Ictpun|(F)|V-REGION
GAGATCAGACTGGACCAG......TCTTCTGCT...GTGGTAAAGAGACCTGGAGAATCTGTGAAGATCTCGTGTAAAA
TAAATGGCCTTGATATG............ACAGCCCACTACATGCACTGGATCCGACAGAAACCAGGGAAAGCTCTGGA
ATGGGTTGGTAGGATGGATGCTGGC......AAAAATCAAGCAATATATGCAGAGTCTGTAAAG...AACCAATTCACA
CTAACAGAAGACGTCCCGGCAAGCACACAGTGCTTAGAGGTCAAGAGTCTGAGGACAGAGGACACTGCGGTTTATTACT
GTGCTCGAACG
>U67446|IGHV7S4*01_Ictpun|(F)|V-REGION
GAGATCAGACTGGACCAG......TCTTCTGCT...GTGGTAAAGAGACCTGGAGAATCTGTGAAGATCTCGTGTAAAA
TAAATCGCTTTGATATG............ACAACCTACTACATGCACTGGATCCGACAGAAACCAGGGAAAGCTCTGGA
ATGGCTTGGTAGGATGGATGCTGGC......AAAAATCAAGCAATATATGCAGAGTCTGTAAAG...AACCGATTCACA
CTAACAGAAGACGTCCCGGCAAGTATACAGTACTTTGAGGTCAAGAGTCTGAGGACAGACGACATTGCGGTTTATTACT
GTGCCCGAGAA
>M57442|IGHV1S1*01_Oncmyk|F|V-REGION
GGTCAGACACTGACGGAG......TCTGAATCA...GTGGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGTACAT
ATTCTGGGTTTGGTGGC...............AACAATTGGAATGCTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTTTCAGCTATTACCAGCAGTGAT...GGTGGCAGCACTTACTACTCCCAGTCTGTTCAG...GGTCAGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCTTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>X92501|IGHV1S2*01_Oncmyk|F|V-REGION
AGTCAGATGCTGACTGAA......TCTGAATCA...GTGGTTAAAACGTTTGAAGAATCCCACAAACTGACTTGCACAT
ATTCTGGGTTTGGTGGC...............AACTATTGGAATGCTTGGATCAGGCAGGCTCCAGGGAAAGGGCTAGA
ATGGGTTGCAACAATTAGTGATTCA......AGCAGTTATATCTACTACTCCCAGTCTATTCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATGTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGAGA
>S63348|IGHV1S3*01_Oncmyk|(F)|V-REGION
AGTCAAACACTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTTTAGAAGCCCACAAACTGACCTGTACAG
CCTCTAATTTAGACATA............AATGGCTATTGGATTGCATGGATCAAACAGGCTCCTGGTAAAGGACTAGA
ATTTGTGGCAGCGCATTATGACATT.........AGAAATATTGTCTACTCTCAGTCTGTTCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCATGAAGCAGGTGTATCTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTGTATTATT
GTGCCAGA
>X81490|IGHV1S4*01_Oncmyk|(F)|V-REGION
GGTCAGACACTAACTGAG......TCTGGACCA...GTTGTAAAAATAACTGGAGAACCACACAAAGTGACCTGTACAG
CTTCTGGCTTCACATTC............AGTAACTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTTGA
ATGGATTGCTCATTATAAATATGAT......AGTGCTGAAATCTACTACTCCCAGTCAGTCCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>L28741|IGHV1S5*01_Oncmyk|(F)|V-REGION
AGTCAGACATTGACCGAG......TCTGGACCA...GTAGTTAAAAATCCTGGGGAACCACACAAACTGACCTGTACTT
ATGATGGAATGTCAAAC............AATAATGCTGATATTAGCTGGATAAGACAGGCTCCTGGTAAAGGGCTGGA
GTGGGTTTGTCATATTTCTGCACCAAGT...GGAGCTGACAAATACTACTCCAAGTCAGTCCAA...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAATAACCTGAAGACTGAAGACTCTGCTGTGTATTATT
GTGCCGGA
>X81484|IGHV1S6*01_Oncmyk|(F)|V-REGION
..............................CCA...GTTGTAAAAATAACTGGAGAACCACACAAAGTGACCTGTACAG
CTTCTGGCTTCACATTC............AGTAACTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTTGA
ATGGATTGCCATTATAAAATATGAT......AGTGCTGAAATCTACTACTCCCAATCAGTCCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>Y08597|IGHV1S7*01_Oncmyk|(F)|V-REGION
GGTCAGACACTAACTGAG......TCTGGACCA...GTTGTAAAAATAACTGGAGAACCACACAAAGTGACCTGTACAG
CTTCTGGCTTCACATTC............AGTAACTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTTGA
ATGGATTGCCATTATAAAATATGAT......AGTGCTGAAATGTACTACTCCCAGTCAGTCCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGAAGGTGTATCTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCGGC
>X81509|IGHV2S1*01_Oncmyk|(F)|V-REGION
GGTCAGAGTCTGGAGTCCATTCCCTCCAATTCA...GTCATGAAAAAGCCTGGAGAAACTCTCAGTCTCTCCTGTAAGG
GATCTGGGTATACCTTT............AGTAGCTACAACACACATTGGATTAGACAACCTGCTGGGAAAGCATTGGA
ATGGATGGGTTATTCTGGATTA............GGCCTAGGCTACCATGCTAAAAGCTTTGCA...GGACGTATGGAA
ACGACTAAAGATAATTCCAACAGCATGATGACTCTGAAGCTGTCTGGTCTGAGAGCAGAGGACTCTGCTGTGTATTACT
GTGCACGA
>X65262|IGHV2S2*01_Oncmyk|(F)|V-REGION
GGTCAGAGTCTGGAGTCCATTCCCTCTAGTCCA...GTCCAGAAAAATCCCGGAGAAACTCTCAGTCTGTCCTGTAAGA
TATCTGGATTCACCTTT............GACAGCCACAACACACACTGGATACGACAGCCAGCAGGAAAATCCCTGGA
GTGGTTGGGTTTTTCTGGATTA............GGCCTAGGTTACCATGCTAAAAGGTTTGAA...GGACGTATGGAA
ACCACTAAAGATACTAGTAACAGCATGTTGACTTTGATGCTGTCTGGTCTGAGAACAGAGGACTCTGCTGTGTATTACT
GTGCAAGA
>X81512|IGHV2S3*01_Oncmyk|(F)|V-REGION
..................ATTCCCTCCAGTCCA...GTCCTGAAAAAGCCTGGAGAAACTCTCAGTCTGTCCTGTAAGA
TATCTGGATACACTGTT............GACAGCCACAGCACACACTGGATACGACAACCAGCAGGAAAATCTCTGGA
GTGGATGGGTTATTCTGGATTA............GGCCTAGGTTACCATGCTAAAACTTTTGAA...GGACGTATGGAA
ACCACTAAAGATAACTCCAACAGCATGTTGACTCTGAAGCTGTCTGGTCTGAGAGCAGAGGACTCTGCAGCGTATTACT
GTGCAAGA
>X81510|IGHV3S1*01_Oncmyk|(F)|V-REGION
CAGACTGAGCTCACACAG......CCAGGCTTT...TTGACCCTGCAGCCTGGACAGCCTCTGACCCTCTCCTGTAAGG
TCTCTGGGTATTCTTTAACC......AGTACCAGCTACTGTACAGGTTGGGTACGACAGCCTGCAGGAAAAGCACTGGA
GTGGGTTGGAAACATGTGTGGCAGT.........GGTAACATATACATCAGTGATAAGCTGAAA...AACAAATTCAGT
ATGTCCAGAGACACTTCCAGCAGCACAGTGACTTTAACAGGACAGAGTCTGCAGACTGAAGACACAGCTGTATATTATT
GTGCTCGA
>L28742|IGHV3S2*01_Oncmyk|(F)|V-REGION
CAGACTGAGCTCACACAG......CCAGGCTCT...TTGACCCTGCAGCCTGGACAGCCTCTGACCCTCTCCTGTAAGG
TCTCTGGGTATTCTTTAACC......AGTACCAGCTACTGTACAGGTTGGGTACGACAGCCTGCAGGAAAAGCACTGGA
GTGGGTTGGATACATGTGTGGCAGT.........GGTAACATATACTACAGTGATAAGCTGAAA...AACAAATTCAGT
ATCTCCAGAGACACTTCCAGCACCACAGTGACTTTAACAGGACAGAGTCTGCAGACTGAAGACACAGTTGTGTATTATT
GTGCTCGA
>L28805|IGHV3S3*01_Oncmyk|(F)|V-REGION
CAGACTGAGCTCACACAG......CCAGGCTCT...TTGACCCTGCAGCCTGGACAGCCTCTGACCCTCTCCTGTAAGG
TCTCTGGGTATTCTTTAACC......AGTACCAGCTACTGTACAGGTTGGGTACGACAGCCTGCAGGAAAAGCACTGGA
GTGGGTTGGATACATGTGTGGCAGT.........GGTAACATATACTACAGTGATAAGCTGAAA...AACAAATTCAGT
ATCTCCAGAGACACTTCCAGCAGCACAGTGACTTTAACAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCGA
>Y08595|IGHV3S4*01_Oncmyk|(F)|V-REGION
CAGACTGAGCTCACACAG......CCAGGCTTT...TTGACCCTGCAGCCTGGACAGCCTCTGACCCTCTCCTGTAAGG
TCTCTGGGTATTCTTTAACC......AGTACCAGCTACTGTACAGGTTGGGTACGACAGCCTGCAGGAAAAGCACTGGA
CTGGGTTGGAAACATGTGTGGCAGT.........GGTAACATATACTACAGTGATAATCTGAAA...AACAAATTCAGT
ATCTCCAGAGACACTTCCAGCAGCACAGTGACTTTAACAGGACAGAGTCTGCAGACTGAAGACACAGCTGTATATTATT
GTGCTCGA
>L28744|IGHV4S1*01_Oncmyk|(F)|V-REGION
...GATGAGATGGATCAG......TCTCCTTCT...CAGGTGAAAAGACCTGGAGACAAGTTTAAATTGTCATGTAAAA
TCTCTGGGTTTGATATG............ACAAACTATTACATGCACTGGATAAGACAGAAACCAGGCAAAGCTCTGGA
GTGGATTGGGGTTATTAACTCTGGTTCA...ACAGATGCTCCAGTCTACTCAGACTCCCTGAAA...GGCCAGTTCACC
CTGACCGAGGACGTCTCTACAAGCACACAGTTCTTAGAGGCCAAGAGTCTGAGTTCAGAGGACTCTGCTGTTTATTATT
GTGCTCGC
>X81513|IGHV5S1*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTAGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGTACAG
CCTCTGGCTTCACATTC............AGTAGCTATAGGATGGGTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATATTAGCACACAG......AGTAATCCAATCTCTTATTCCCAGTCAGACCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAGGATGGAGAACACAGCAGTGTATTACT
GTGCTAGA
>L28745|IGHV5S2*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGATTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGCTACCATATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT......GGATCGAGTCCATTCTATTCTCAGTCAATACAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCATTGTATTACT
GTGCCCGG
>U04616|IGHV5S3*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGTGAATCACACAAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTATGCGATGAACTGGGTCAGACAGGCTCCTGGGAAAGGATTAGA
GTGGATTGCTTATATCAGCACAGCT......AGTACACCCATATATTACTCCCAGTCAGTCCAG...GGTAGATTCACC
ATCTCTAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAAGACACAGCGGTGTATTACT
GTGCCCGG
>U04615|IGHV5S4*01_Oncmyk|(F)|V-REGION
GGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAATCCTGGAGAATCACACAAACTGACCTGTACAG
GCTCTGGGTTCACATTC............AGTAGCTATGGGATGAACTGGATCAGACAGGCTCCTGGGAAAGGATTGGA
GTGGATTGCCTATAGTTATAGT............ACTACTACATATTACTCCCAGTCATTTCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTATACCTACAGATGAACAGTCTGAGGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGA
>X81493|IGHV5S5*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGATTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGTTACCATATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT......GGATCGAGTCCATCTATTCTCAGTCGAATACAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCATTGTATTACT
GTGCCCGG
>X81492|IGHV5S6*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGATTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGCTACCACATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT......GGATCGAGTCCATTCTATTCTCAGTCAATACAG...GGTAGATTGACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCACTGTATTACT
GTGCCCGG
>X81491|IGHV5S7*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGGTTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGCTACCACATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT......GGATCGAGTCCATTCTATTCTCAGTCAATACAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCATTGTATTACT
GTGCCCGG
>Y08596|IGHV5S8*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGATTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGCTACCATATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTCTTGCCCTTTATACACACTGG......TGGATCGAGTCCATTCTATCTCAGTCAATACAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCATTGTATTACT
GTGCCCGG
>Y08599|IGHV5S9*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGATTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGCTACCATATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT.........GGATCGAGTCCATCTATCTCAGTCAATCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCATTGTATTACT
GTGCACAC
>X81481|IGHV6S1*01_Oncmyk|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGTCAGGTCAACCACTGACCATCTCTTGTAAGG
TTTCATATTCTGTAGGT...............AGCTATTACACAGCTTGGATCCGGCAGCCTGCAGGGAAAACACTGGA
GTGGATTGGAATGAAATATACT............GGAGGAACGCACCACAAAGACTCCCTGAAA...AATAAGTTCAGC
CTCACAGTAGACTCCTCCAGCAATACTGTGACTTTAACAGGACAGAGTCTGCAGACTGAGGACACAGCTGTGTATTATT
GTGCTCGC
>L28746|IGHV6S2*01_Oncmyk|(F)|V-REGION
...TATGAACTCTCCCAG......CCAGCATCT...ATGACTGTCCTGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AACGCTTGGACAGCTTGGATCCGAAAGCCTGCAGGGAAAACACTGGA
GTGGATTGGAAATGTATATTCT............GGAGTCACACAATACAAGGATTCGCTGAAG...AACAAGTTCAGC
CTCTCAGTAGACTCTAGCAGTAATACTGTGTTTTTAAAAGGGCAGAACCTTCAGACTGAAGGCTCAACTGTGTATTATT
GTGCCCTA
>X81496|IGHV6S3*01_Oncmyk|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGTCAGGTCAACCACTGACCATCTCTTGTAAGG
TTTCATATTCTGTAGGT...............ACGTATTACACAGCTTGGATCCGGCAGCCTGCACCCAAAACACTGGA
GTGGATTGGAATGAAATATACT............GGAGGAACGCACCACAAAGACTCCCTGAAA...AATAAGTTCAGC
CTCACAGTAGACTCCTCCAGCAATACTGTGACTTTAACAGGACAGAGTCTGCAGACTGAGGACACAGCTGTGTATTATT
GTGCTCGC
>X81494|IGHV6S4*01_Oncmyk|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...TTGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTAGT...............AGCTACTACACGGCTTGGATTCGACAGCCTGCAGGGAAAACACTGGA
GTGGATTGGATATATTAGTAGTGGT.........GGAGGCACAGCTTATAAAGATTCACTGAAA...AACAAGTTCAGC
ATCACCAGAGACACGTCCAGCAACACATTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCGC
>X81497|IGHV6S5*01_Oncmyk|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGGCTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCTGTTGCT...............AGCTATTGGACAGCTTGGATCCGACAACCTGCAGGGAAAGGACTGGA
GTGGATTGGGCAAATATATACT............GGAAACACAATCTACAAGGATTCACTGAAA...AACAAGTTCAGC
CTCACTTTAGACTCCACTAACAAGATAGTGACTTTAACAGGACAGAACCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCCCGA
>X81487|IGHV6S6*01_Oncmyk|(F)|V-REGION
........................CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATGTCCTGTAAGG
TCTCATATTCTGTTGCT...............AGCTATTGGACAGCTTGGATCCGACAACCTGCAGGGAAAGGACTGGA
GTGGATTGGGCAAATATATACT............GGAAACACAATCTACAAGGATTCACTGAAA...AACAAGTTCAGC
CTCACTTTAGACTCCTCTAACAAGATAGTGACTTTAACAGGACAGAACCTGCAGACTGAAAACACAGCTGTGTATTATT
GTGCCCGA
>X81495|IGHV6S7*01_Oncmyk|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGTCAGGTCAACCACTGACCATCTCTTGTAAGG
TTTCATATTCTGTAGGT...............AGCTATTACACAGCTTGGATCCGGCAGCCTGCACCCAAAACACTGGA
GTGGATTGGAATGAAATATACT............GGAGGAACGCACCACAAAGACTCCCTGAAA...AATAAGTTCAGC
CTCACAGTAGACTCCTCCAGCAATACTGTGACTTTAACAGGAACGAGTCTGCAGACTGAGGACACAGCTGTGTATTATT
GTGCTCGC
>Y08600|IGHV6S8*01_Oncmyk|(F)|V-REGION 
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATATCCTGTAAGG
TCTCATATCCTGTTACT...............AGTTATTGGACAGCTTGGATCCGACAACCTGCAGGGAAAGGACTGGA
GTGGATTGGGCAGATATATACT............GGAAACACAATCTACAAGGATTCACTGAAA...AACAAGTTCAGC
CTCACTTTAGACTCCTCTAACAAGATAGTGACTTTAACAGGACAGAACCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCCCGA
>Y08602|IGHV6S9*01_Oncmyk|(F)|V-REGION 
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGTCAGGTCAACCACTGACCATCTCTTGTAAGG
TTTCATATTCTGTAGGT...............AGCTATTACACAGCTTGGATCCGGCAGCCTGCAGGGAAAACACTGGA
GTGGATTGGAATGAAATATACT............GGAGGAACGCACCACAAAGACTCCCTGAAA...AATAAGTTCAGC
CTCACAGTAGACTCCTCCAGCAATACTGTGACTTTAACACCACAGAGTCTGCAGACTGAGGACACAGCTGTTTATTATT
GTGCTCGC
>L28747|IGHV7S1*01_Oncmyk|(F)|V-REGION
GGTCTTGAACTCAGCCAG......CCAAATGTA...ATGGTTGTAAAGCCTGGAGAGTCTCTGAGCATCACCTGTAAGG
TCTCTGGGTATTCTGTTAGTGATAGCAGCATAAGCTTTGCCACAGGTTGGGTTCGAAAGCCTGCAGGGAAAGCAATGGA
GTGGATTTCCCATATATGGGATAAT.........GGAGACATATACAAAAATGATGCATTGAAA...AACAAGTTCAGC
ATTTCAACACATGCCTCCAGCAACTCTGTGTCTTTACAAGGGAAGAGCCTGCAACCTGAAGACACAGCTGTGTATTACT
GTGCTCGG
>X81482|IGHV8S1*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCAGTTACATGCACTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATAATTTACTATTACTCTGAT.........AGTAACAAGAGCAATGCCCCTGTAGTACAG...GGTAGATTCACA
GCGTTGAAGGAC......AGCACTAATTTCTATCTGCACATGAACCTGTTGAAGCCAGAGGACTCCGCAGAGTATTACT
GTGCTAGA
>X81501|IGHV8S2*01_Oncmyk|(F)|V-REGION
CAGATTGTACTCACACAG......GCTAGTCAG......CCAGGGACTCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGGGGTAATATGTTTTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAC.........AGTGACAAGAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GGATCAAAGGAC......AGCAGTAATTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>X81503|IGHV8S3*01_Oncmyk|(F)|V-REGION
CAGATTGTACTCACACAG......GCTGAGTCA...GTCCAGGGGACTCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCACTAATATGTTTTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAC.........AGTGACAAGAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GCATCAAAGGAC......AGCAGTAATTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGAGTATTACT
GTGCTTAT
>X81499|IGHV8S4*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......ACTGAACAGTCAGTCCAGGGGACTCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCACTAATATGCACTGGATCCGCCAAGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAC.........AGTGACAAGAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GCATCAAAGGAC......AGCAGAAATTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>X81488|IGHV8S5*01_Oncmyk|(F)|V-REGION
.........................................................TCCCTCAAACTCACGTGTGCCT
GTAGTGGATTCACTCTA............AGCAGCACTAATATGCACTGGATCCGCCAAGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAC.........AGTGACAAGAGCAATGCCCAGGTAGTACAG...GGCCGATTCACT
GCATCAAAGGAC......AGCAGTAATTTATATCTGCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>X81498|IGHV8S6*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGTAGTTACATGCACTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTACTCTGAT.........AGTAACAAGAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GAATCAAAGGAC......AGCAGTAATTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>X81502|IGHV8S7*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCGGTCCAGGGGACACCTGGGGGATCCCTCAAACTCACATGTGCCT
GTAGTGGAATCACTCTC............AGCAGCTCTTATATGCACTGGATTCGCCAAGCACCTGGAAAAGGACTTGA
ATGGATAATTTACTATTATTCTGAC.........AGTTACAAGAGCAATGCCCAGGTAGTACAG...GGTCGATTCACT
GCATCGAAGGAC......AGCACTAATTTCTATCTGCACATGAGCCAGTTGAAGTCAGAGGACTCTGCAATGTATTACT
GTGCTAAA
>X81500|IGHV8S8*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCAGTTACATGCACTGGATCCGGGAGGCACCTGGGAAAGGACTTGA
ATGGATAATTTACTATTACTCTGAT.........AGTAACAAGAGCAATGCCCCTGTAGTACAG...GGTAGATTCACA
GAGTTGAAGGAC......AGCACTAATTTCTATCTGCACATGAACCTGTTGAAGCCAGAGGACTCGGCAGTGTATTACT
GTGCTAGA
>X81483|IGHV8S9*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCAGTTACATGCACTGGATCCGCCAAGCACCTGGAAAAGGACTTGA
ATGGATAATTTACTATTACTCTGAT.........AGTAACAAGAGCAATGCCCCTGTAGTACAG...GGTAGATTCACA
GCGTTGAAGGAC......AGCACTAATTTCTATCTGCACATGAACCTGTTGAAGCCAGAGGACTCGGCAGTGTATTACT
GTGCTAGA
>Y08601|IGHV8S10*01_Oncmyk|(F)|V-REGION
CAGATCGTCCTCACACAG......GCTGAGTCA...GTCCAGGGGACTCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCATAATTATATTTTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAC.........AGTGACAAAAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GCATCAAAGGAC......AGCAGTCCTTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGG
>Y08889|IGHV8S11*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGTAGTTACATGCACTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTACTCTGAT.........AGTAACAAGAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GGATCAAAGGAC......AGCAGTAATTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>X81505|IGHV9S1*01_Oncmyk|(F)|V-REGION
GGACAGTCACTCACCTCC......TCTGAGTCA...GTGGTGAAGAAACCTGGAGAGTCAGTAACACTGTCATGTACTG
TGTATGGTTTCTCCATG............GGTAGCTACTACATGCACTGGATCCGTCAGAAACCAGGGAAAGGTCTAGA
GTGGATTGGACGGATTGACACTGGC.........ACTGGCACTGTATTTGCTCAGTCCCTCCAG...GGCCAGTTCACC
ATCACCAAAGACAACTCCAAAAACCAGTTGTATTTAGAGGTGAAAAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGG
>X81504|IGHV9S2*01_Oncmyk|(F)|V-REGION
GGACAGTCACTCACCTCC......TCTGAGTCA...GTGGTGAAGAGCCCTGGAGAGTCAGTAACACTGTCATGTACTG
TGTCTGGTTTCTCCATG............GATAGCTACTACATGCACTGGATCCGTCAGAAACCAGGGAAAGGTCTAGA
GTGGATTGGCCTTATTGACACTGGC.........ACTGGCACTGTATTTGCTCAGTCCCGCCAG...GGCCAGTTCACC
ATCACCAAAGACAACTCCAAAAACCAGTTGTACTTAGAGGTGAAAAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCAAGA
>X81507|IGHV9S3*01_Oncmyk|(F)|V-REGION
GGGCAGTCACTCACCTCC......TCTGAGCCA...GTAGTGAAGAGACCTAGTGAGTCAGTAACACTGTCCTGTACTG
TGTCTGGATTCTCCATG............GGTAGCTACTGGATGCAATGGATCCGTCAGAAACCAGGGAAAGGATTGGA
GTGGATTGGATTCATTGACACT..........GGAACCACTGCTTATTATGCCCAGTCTCTCCA...GGCCAGTTCACC
ATCACCAAAGACACCTCCAAAAACCAGCTGTACTTAGAGATGAAAAGTCTGAGGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>X81506|IGHV9S4*01_Oncmyk|(F)|V-REGION
GGGCAGTCACTCACCTCC......TCTGAGCCA...GTCGTGAAGAGACCTAGTGAGTCAGTAACACTGTCCTGTACTG
TGTCTGGATTCTCCATG............GGTAGTTGCTGGATGCAATGGATCCGTCAGAAACCAGGGAAAGGATTGGA
GTGGATTGGATTCATTGACACTGGA.........ACCACTGCTTATTATGCCCAGTCTCTCCAG...GGCCAGTTCACC
ATCACCAAAGACACCTCCAAAAACCAGCTGTACTTAGAGATGAAAAGTCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>Y08603|IGHV9S5*01_Oncmyk|(F)|V-REGION
GGGCAGTCACTCACCTCC......TCTGAAGCC...GTCGTGAAGAGACCTAGTGAGTCAGTAACACTGTCCTGTACTG
TGTCTGGATTCTCCATG............GGTAGCTACTGGATGCAATGGATCCGTCAGAAACCAGGGAAAGGATTGGA
GTGGATTGGATTCATTGACACTGGA.........ACCACTGCTTATTATGCCCAGTCTCTCCAG...GGCCAGTTCACC
ATCACCAAAGACACCTCCAAAAACCAGCTGTACTTAGAGATGAAAAGTCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>Y08604|IGHV9S6*01_Oncmyk|(F)|V-REGION
GGGCAGTCACTCACCTCC......TCTGAGCCA...GTAGTGAAGAGACCTAGTGAGTCAGTAACACTGTCCTGTTCTG
TGTCTGGATTCTCCATG............GGTAGCTACTGGATGCAATGGATCCGTCAGAAACCAGGGAAAGGATTGGA
GTGGATTGGATTCATTGACACTGGA.........ACCACTGCTTATTATGCCCAGTCTCTCCAG...GGCCAGTTCACC
ACCACCAAAGACACCTCCAAAAACCAGGTGTACCTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGG
>X81508|IGHV10S1*01_Oncmyk|(F)|V-REGION
GATATTGAACTCATCCAG......TCTGGTCCA...GTGGTTATAGAACCAGGAGTGTCTTTCAGCATCTCCTGCAAAT
TCTCTGGGTTTTCTATA............TCTTCTTATTGTCTTGGATGGATACGACAAGCTGAAGGGAAAGCTTTGGA
GCATGTTGGTGTTACATGCAGT............AGTAGTACTTACACTGTAGACTCACTAAAG...AGCAAGATCACT
TCTAGATATGACAGTTCCAGCAGTACAGTGTTTCTACAAGGGAACAACTTCCAGACTGAAGACACAGCTGTGTATTATT
GTGCTAGG
>X81511|IGHV11S1*01_Oncmyk|(F)|V-REGION
AGCATTAGTTTGACCTCC......TCCCCTGCT...CAACTCAAACCCCCTGGAGAGTCAGTGAAACTATCTTGCCAAG
TCTCTGGCTATGCCCTG............ACAAGCCAAGGTACAGGTTGGATACGACAGCAGCCAGGGAAAACACTGGA
GTGGATTGGGATCATCTGGAGTGGT.........GGATCAATTGAATCTGGAGCCTCTTTTAAG...AGGAGATTCACC
ATCTCCAGAGAC...AGTAGTAATGTACTGTACTTAGACATCACCAGTCTGCAGGCTGAGGACACAGCTGTGTATTATT
GTGCTCGG
>AB052658|IGHV1S1*01_Paroli|(F)|V-REGION
TGTCAAACTTTGACGCAG......CCAGCCTCT...GCGACTGTGCAGCCAGGTCAACCTCTGACCATCAGCTGTCAGG
TCTCTTATTCTATGAGC...............AGCTACAGCACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGGGCGAAATATACA............GGAGCTTCATACTATAAAGAGTCACTGAAG...AACAAGTTCAGC
ATCGACTTAGACACTTCCAGCAACACAGCGACTCTAAAGGGACAGAACATGCAGCCTGGAGACACTGCTGTGTATTACT
GTGCCAGA
>AB052744|IGHV1S2*01_Paroli|(F)|V-REGION
TGTGAAACTTTGACGCAG......CCAGCCTCT...GTGACTGTGCGGCCAGGTCAACCTCTGACCATCAGCTGTCAGG
TCTCTTATTCTGTCAGC...............AGCTACCACACAGGTTGGATCAGACAACCTGCAGGAAAAGGACTGGA
GTGGATTGGAAGCAGGCGTTCTGGA.........GGGGACACTTACTATAAAGAGTCACTAAAG...AACAAGTTCAGT
ATCGACTTAGACACTTCCAGCAACACAGTGAGTCTAAAGGGACAGAACATGCAGCCTGGAGACACTGCTGTGTATTACT
GTGCCAGA
>AF226284|IGHV1S3*01_Paroli|(F)|V-REGION
TGTGAAACTTTGACGCAG......CCAGCCTCT...GTGACTGTGCAGCAAGGTCAACCTCTGACCATCAGCTGTCAGG
TCTCTTATTCTTTTAGC...............AGCTACGGCTCAACTTGGATCAGACAGCCTGCAGGAAAAGGACTGGA
GTGGATTGGAAGCACGCGTTATGGA.........TACAGCACATACTATAAAGAGTCACTAAGG...AACAAGTTCGGT
ATCCACTTGAACTATTCCAGCAACACAGCGACTCTAAAGGGACAGAACATGCAGCCTGGAGACACTGCTGTGTATTACT
GTGCCAGA
>AJ000361|IGHV1S1*01_Salalp|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGAATCA...GTGGTTAAAAAGCCTGGAGATTCTCACAAATTGACCTGTACAT
ATTCTGGGTTTGGTGGC...............AACTATTGGAATGCTTGGATCAGACAGGCTTCTGGGAAAGGACTGGA
GTGGGTTGCAACTATCAGTGATGGT.........GGCAGGACTTACTACTCTCAGTCTGTTCAG...GGTCAGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAACAATCTGAACACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>AJ000367|IGHV1S2*01_Salalp|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGAATCA...GTGGTTAAAAAGCCTGGAGATTCTCACAAATTGACCTGTACAT
ATTCTGGGTTTGGTGGC...............AACTATTGGAATGCTTGGATGAGACAGGCTTCTGGGAAAGGACTGGA
GTGGGTTGCAACTATCAGTGATGGT.........GGCAGGACTTACTACTCTCAGTCTGTTCAG...GGTCAGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAACAATCTGAACACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>AJ000360|IGHV2S1*01_Salalp|(F)|V-REGION
GGTCAGAGTATGGAGTCCATTCCCTCTGGTCCA...GTCCCGAAAAAGCCTGGAGATACTCTCAGCCTCTCCTGTAAGG
GATCTGGCTTTACATTT............AGTAGCTATGGCATGCACTGGTTAAGACAACCTGCAGGAAAAGCACTGGA
TTGGATGGGACTGATCTATTATGAT......GCCAGCAAAACAATCTATTCAAAAAATATTGAA...GGACGTATAGAA
GTCACCAGAGATAATTCTAACAGCATGGTGTATCTGAAGCTGTCTGGTCTGAGAGCAGAGGACTCTGCTGTGTATTACT
GTGCAAGA
>AJ000363|IGHV2S2*01_Salalp|(F)|V-REGION
GGACAGAGTCTGGAGTCCAGTCCCTCCAGTTCA...GTCCTGAAAAAGCTTGGAGAAACTATAAGTCTCTCCTGTAAGA
TATCTGGATTCACCTTT............GGCAGCCACAACACACACTGGATACGACAGCCAGCTGGAAAGTCCCTGGA
ATGGATGGGTTACTCTGGATTA............GGCCTAGGTTACCATGCTAAAAGGTTTGAA...GGACGCATGGAA
ACAACTAAAGCTAATTCCAACAGCATGATGACTCTGAAGCTGTCTGGTCTCAAAGCAGAGGACTCTGCTGTGTATTACT
GTGCACGA
>AJ000366|IGHV3S1*01_Salalp|(F)|V-REGION
...AGTGAACACAACCAG......CCAAACTCA...TTGAGTGTAAAGCGTGAAGAAACTTTGACTATTAGTTGTGCAA
TCTCGGGGTATTCTCTTACA......GACAACAGCTATGTGGTAGCCTGGAACCGACAGCCTGCAAAGAAACCAATGGA
ATGTATTTTTTATATTTGGGGTGGT.........GGTAGTTTTTACCTTAACAACGCACTAAAA...AACAAGTTCAGC
TTTAGAAGAGACATGTCCAGCAGTACTTCAACTCTAACAGGACAGAACCTGCAGACTGAAGATACAGCTGTGTATTATT
GTGCTCGG
>AJ000368|IGHV4S1*01_Salalp|(F)|V-REGION
GATATAAGGCTGGATCAG......TCTCCTCCT...CAAGTGAAAAGACCTGGAGACACTGTTAAATTGTCCTGTACAA
TCTCTGGTTTCTCAATG............AGTGGCTTCTGGATACACTGGATGAGGCAGAACCAAGGCAAAGCCCTAGA
GTGGATCGGGAGAATGAATAGC............AACTCTCCAGTCTACTCAGACTCCCTGAAA...GGCCAGTTCGCC
CTGACTGAGGACGTCTCCACAAGCACACAGTTCTTAGAGGCCAAGAGTCTGAGATCAGAGGACTCTGCTGTTTATTATT
GTGCCCGA
>AJ000359|IGHV5S1*01_Salalp|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTAGTTAAAAGGCCTGGAGAATCCCACAAACTGACCTGTGCGG
CGCCTGGGTTCACGTTC............AGTAGCTATTATATGGGCTGGATCAGACAAGCTAAAGGGAAAGAGTTTGA
GTGGATTGGTCATATTCATGGT............GGTAATACGTATTACTCCCAGTCATTTCAG...GGTAGATTCACC
ATCTCCAGGGAAGACTCCAGCAGTAAACTGTACATACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGGCCGG
>AJ000358|IGHV5S2*01_Salalp|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTTGTTAAAAAGCCTGGAGAATCCAACACACTGAGTTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTACCATATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT......GGATCGAGTCCATTCTATTCCCAGACAGTCCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAACTGTTTCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCACTGTATTACT
GTGCCCGG
>AJ000364|IGHV5S3*01_Salalp|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTGGTTAAAACACCTGGAGAATCCCACAAACTGACCTGTACAG
CTTCTGGGTTCACTTTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATAGCTTATAGTCATAGC............ACTACTGCTTACTACTCCCAGTCATTTCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGA
>AJ000369|IGHV6S1*01_Salalp|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAATCACTGACCATCTCCTGTAAGG
TCTCATATTCTGTTACT...............AGCTATTGGACAGCTTGGATCCGACAGCCTGCAGGGAAAACACTGGA
GTGGATTGGGCAAATATATACT............GGAAACACAATCTACAAGGATTCACTGAAA...AACAAGTTCAGC
CTCACTTTAGACTCCTCTGACAAGATAGTGGCTCTAACAGGGCAGAACCTGCAGACTGAAGACACAGCTGTGTATTATT
GTTCCCGA
>AJ000370|IGHV6S2*01_Salalp|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAAGTCAACTACTGACCATCTCCTGTAAGG
TCTCATATTCTGTTACT...............AGTGTTACTACATTCTGGATTCGACAGCCTGCTGGGAAAACATTGGA
GTGGATTGGATATATCAATAATGCT.........GGAAGCACAGCTTATAAAGATTCACTGAAA...AACAAGTTCAGC
ATCACCAGAGACACTTCCAGCAACACATTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCAC
>AJ000362|IGHV8S1*01_Salalp|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCCGGGGGATCCCTCAAACTCACATGTGCCT
GCAGTGGATTTACTCTA............AGCAGCTACAGAATGCACTGGATCCGGCAAGCACCTGGAAAAGGACTTGA
ATGGATAATTTACTATCATTCTGAC.........ACTGACAAGAGCAATGCCCAGGTAGTACAG...GGCCGATTCACT
GCATCAAAGGAC......AGCACTAATTTCTATCTGCACATGAGCCAGTTGAAGCCAGAGGACTCTGCATTGTATTACT
GTGCTAGT
>AJ000365|IGHV11S1*01_Salalp|(F)|V-REGION
AGCATTAGTTTGACCTCC......TCCCCTGCT...CAACTCAAACCTCCTGGAGAGTCAGTGAAACTATCTTGCCAAG
TCTCTGGCTATGCCCTG............ACAGACTATGGTACAGGTTGGATACGACATCAGGCAGGGAAAACACTGGA
GTGGATTGGGATCATTTGGGCCGGT.........GGATCCATCATCTCTGGAGACTCTTTTAAG...AGCAGATTCACC
ATCTCCAGAGAC...AGTAGTAATGTACTGTACTTAGACATCACCAGTCTGCAGGCTGAGGACACAGCTGTGTATTATT
GTGCTCGG
>AJ296096|IGHV1S1*01_Scomax|(F)|V-REGION
...............................................................................
...............................................................................
..TGGGCATGCACTGGATTGGAATGAGATCTACTGGAGTTTCATACTACAAAGATTCATTAAAG...AACAAGTTCAGT
ATCGACTTAGACACTTGCAGCAAAACTGTGACTCTAAATGGACAGAATGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAAG
>AF273397|IGHV1S1*01_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTGGTTAAAAAACCTGGAGAATCCCACCAACTGACCTGTACAG
GCTCTGGGTTCACTTTC............AGTAGCTACTGGATAACTTGGATCAGACAGGCTCCTGGGAAAGGACTAGA
ATTTATAGCAGCACATTATAACAGC.........ATAAATATTGCCTACTCCCAGTCTGTTCAG...GGTCGGTTCACC
ATCTCTAGAGATGACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCCTGAACACTGAAGACTCCGCTGTTTATTATT
GTGCCAGA
>AF273398|IGHV1S1*02_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTGGTTAAAAAACCTGGAGAATCCCACCAACTGACCTGTACAG
GCTCTGGGTTCACTTTC............AGTAGCTACTGGATAGCTTGGATCAGACAGGCTCCTGGGAAAGGACTAGA
ATTTATAGCAGCACATTATAACAGC.........ATAAATATTGCCTACTCCCAGTCTGTTCAG...GGTCGGTTCACC
ATCTCTAGAGATGACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCCTGAACACTGAAGACTCCGCTGTTTATTATT
GTGCCAGA
>AF273399|IGHV1S1*03_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAC......TCTGGACCA...GTGGTTAAAAAACCTGGAGAATCCCACCAACTGACCTGTACAG
GCTCTGGGTTCACTTTC............AGTAGCTACTGGATAGCTTGGATCAGACAGGCTCCTGGGAAAGGACTAGA
ATTTATAGCAGCACATTATAACAGC.........ATAAATATTGCCTACTCCCAGTCTGTTCAG...GGTCGGTTCACC
ATCTCTAGAGATGACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCCTGAACACTGAAGACTCCGCTGTTTATTATT
GTGCCAGA
>AF273396|IGHV1S2*01_Salsal|(F)|V-REGION
GGTCAGACACTAACTGAG......TCTGGACCA...GTTGTTAAAAAGCCTCAGGAATCCCACAAACTGACCTGTACAG
CCTCTGGTTTTACTTTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTGTCCTATATTAGCAGTGAT......GGTGGCAGCACTTACTACCCCCAGTCTGTTCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAAATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>AF273402|IGHV2S1*01_Salsal|(F)|V-REGION
GGCCAGAGTCTGGAGTCCATTCCCTCTAGTCCA...GTCCTGAAAAAGCCTGGTGAAACTCTCAGTTTGTCCTGTAAGA
TATCTGGATACACATTT............GACAGCCACCACACACACTGGATACGACAGCCAGCAGGAAAATCTCTGGA
GTGGATGGGTTATTCTGGACTA............GGCCTAGGTTACCATGCTAAAAGGTTTGAA...GGACGTATGGAA
ACCACTAAAGCTACAAGCAACAGCATGTTGACTTTGAAGCTGTCTGGTCTGAGAGCAGAGGACTCTGCTGTGTATTACT
GTGCACGG
>AF273401|IGHV2S2*01_Salsal|(F)|V-REGION
GGTCAGAGTCTGGAGGTCATTCCCTCCAGTCCA...GTCCAGAAAAAGCCTGGAGAAACTCTCAGTCTGTCCTGTAAGA
TATCTGGATATACCGTT............ACCAGCCACCACACACACTGGATACGACAGCCAGCAGGAAAATCCCTGGA
GTGGATGGGTTTTTCTGGATTA............GGCCTAGGTTACCATGCTAAAAAGTTTGAA...GGACGTATGGAA
ACCACTAAAGATACTAGAAACAGCATGTTGACTTTGATGCTGTCTGGTGTGAGAGCAGAGGACTCTGCTGTGTATTACT
GTGCAAGA
>AF269073|IGHV2S2*02_Salsal|(F)|V-REGION
GGTCAGAGTCTGGAGGTCATTCCCTCCAGTCCA...GTCCAGAAAAAGCCTGGAGAAACTCTCAGTCTGTCCTGTAAGA
TATCTGGATATACCGTT............ACCAGCCACCACACACACTGGATACGACAGCCAGCAGGAAAATCCCTGGA
GTGGATGGGTTTTTCTGGATTA............GGCCTAGGTTACCATGCTAAAAAGTTTGAA...GGACGTATGGAA
ACCACTAAAGATACTAGAAACAGCATGTTGACTTTGATGCTGTCTGGTGTGAGAGTAGAGGACTCTGCTGTGTATTACT
GTGCAAGA
>AF269072|IGHV2S3*01_Salsal|(F)|V-REGION
GGTCAGAGTCTGGAGGCCATTCCCTCCAGTCCA...GTCCTGAAAAACCCTGGAGAACCTGTCAGCCTCTCCTGTAAGG
GATCTGGCTTTACCTTT............GGTAGCTACCATATGGGCTGGATAAGACAACCAGCAGGAAAAGCTCTAGA
ATGGATAGGCATTATATGGAATGAT......GCTAGTGGAACTGCATACGCAAAAAGTGTTGAA...GGGCGTATAGAA
GTCACCAGAGATAATTCTAACAGCATGGTGTATCTGAAGCTGTCTGGTCTGAGAGCAGAGGACTCTGCTGTGTATTACT
GTGCAAGA
>AF273404|IGHV3S1*01_Salsal|(F)|V-REGION
GGTCAAACAATGGAATCCATTCCCTCCAGTCCA...CTCCAGAAAAAGCCAGGAGAAACTCTCAACCTCTCGTGCAGAG
GAACTGGGTATACCTTT............ACAAGCTATGGTATGAACTGGATTCGCCAACCTACAGGGAAACCATTGGA
ATGGATGGGCTGGATCAACACCAAT......ACTGGAGCAGCAGGCTATGCCAAAACCCTGGAG...GGACGGATTGAA
CTGACCAAAGACAGCTCAGTGAGCATGACTCATCTGAAACTGTCTGGTCTGAAGGCAGAGGACTCTGCTGTGTATTACT
GTGCACGC
>AF273405|IGHV3S1*02_Salsal|(F)|V-REGION
GGTCAAACAATGGAATCCATTCCCTCCAGTCCA...CTCCAGAAAAAGCCAGGAGAAACTCTCAACCTCTCGTGCAGAG
GAACTGGGTATACCTTT............ACAAGCTATGGTATGAACTGGATTCGCCAACCTACAGGGAAACCATTGGA
ATGGATGGGCTGGATCAACACCAAT......ACTGGAGCAGCAGGCTATGCCAAAACCCTGGAG...GGACGGATTGAA
CTGACCAAAGACAGCTCAGTGAGCATGACTCATCTGAAACTGTCTGGTCTGAAGGCAGAGGACTCTACTGTGTATTACT
GTGCACGC
>AF273407|IGHV3S1*03_Salsal|(F)|V-REGION
GGTCAAACAATGGAATCCATTCCCTCCAGTCCA...CTCCAGAAAAAGCCAGGAGAAACTCTCAACCTCTCGTGCAGAG
GAACTGGGTATACCTTT............ACAAGCTATCCTATGAACTGGATTCGCCAACCTACAGGGAAACCATTGGA
ATGGATGGGCTGGATCAACACCAAT......ACTGGAGCAGCAGGCTATGCCAAAACCCTGGAG...GGACGGATTGAA
CTGACCAAAGACAGCTCAGTGAGCATGACTCATCTGAAACTGTCTGGTCTGAAGGCAGAGGACTCTGCTGTGTATTACT
GTGCACGC
>AF273408|IGHV3S1*04_Salsal|(F)|V-REGION
GGTCAAACAATGGAATCCATTCCCTCCAGTCCA...CTCCAGAAAAAGCCAGGAGAAACTCTCAACCTCTCGTGCAGAG
GAACTGGGTATACCTTT............ACAAGCTATGGTATGAACTGGATTCGCCAACCTACAGGGAAACCATTGGA
ATGGATGGGCTGGATCAACACCAAT......ACTGGAGCAGCAGGCTATGCCAAAACCCTGGAG...GGACGGATTGAA
CTGACCAAAGACAACTCAGTGAGCATGACTCATCTGAAACTGTCTGGTCTGAAGGCAGAGGACTCTGCTGTGTATTACT
GTGCACGG
>AF273409|IGHV3S1*05_Salsal|(F)|V-REGION
GGTCAAACAATGGAATCCATTCCCTCCAGTCCA...CTCCAGAAAAAGCCAGGAGAAACTCTCAAGGTCTCGTGCAGAG
GAACTGGGTATACCTTT............ACAAGTTATGGTATCAACTGGATTCGCCAACCTACAGGGAAACCATTGGA
ATGGATGGGCTGGATCAACACCAAT......ACTGGAGCAGCAGGCTATGTCAAAACCCTGGAG...GGACGGATTGAA
CTGACCAAAGACAGCTCAGTGAGCATGACTCATCTGAAACTGTCTGGTCTGAAGGCAGAGGACTCTGCTGTGTATTACT
GTGCACGC
>Y12452|IGHV5S1*01_Salsal|F|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGTACAC
GCTCTGGCTTCACATTC............ACTAGCTATTATATGGGCTGGATCAGACAAGCTAAAGGGAAAGAGTTTGA
GTGGATTGGTCATATTCATGGT............GGTACCACTTACTACTCCCAGTCATTTCAG...GGTAGATTCACC
ATTTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCCCGGTACA
>Y12454|IGHV5S2*01_Salsal|P|V-REGION
GGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
TCTCTGGGTTCACATTC............AGTAGCTATGGGATGGGTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATATTAGCACACAG......AGTAATCGAATCTCTTATTCCCAGTCAGTCCAG...GGTAGATTCACC
ATCTCCAGAGACGACTCTAGCAGTAAACTGTACTTACAGCTGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTATT
GTGCATGAGAGT
>Y12455|IGHV5S4*01_Salsal|P|V-REGION
GGCCAGACACTGACTGAG......ACTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACAAACAGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTATGAGATGAACTGGATCAGACAGGCCCCTGGGAAAGGACTGGA
GTAGGTTGCTTTTATTAGCACAGCT......AGTACTCCCATCTCTTACTCACAGTCAGTCCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCAAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAATGAGGACACAGCAGTGTATTACT
GTGCTAGAGAGT
>AF273412|IGHV5S5*01_Salsal|(F)|V-REGION
GGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTATGGGATGGGTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATATAGACACAGCT......AGTACTCCCATCTCCTACTCCAAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGACGACTCTAGCAGTAAACTGTACTTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTATT
GTGCTAGAGAT
>AF273410|IGHV5S6*01_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTAGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTATCTACTACATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTTGGTTGCTTATATAGGCACATCT......AGTAGTCCAATCTCTTACTCCCAGTCAGTCCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF269078|IGHV5S7*01_Salsal|(F)|V-REGION
...CAGACATTGACTGAG......TCTGGACCA...GTAGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTGTGGGTTCACATTC............AGTAGCTACTACATGGCTTGGATTAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTTGCTTATATAGGCACATCT......AGCAGTCCAATCTCTTACTCCCAGTCAGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAGTTGTACCTACAGATCAACAGTTTGAAGAGTGAAGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF269069|IGHV5S8*01_Salsal|(F)|V-REGION
..................................................................CTGTCCTGTAAAG
TTTCTGGGTTCACATTC............AGTAGCTATGGAATGAACTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATAGCCATAGT............ACTACTGTTTACTACTCCCAGTCAGTCCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGGCCGGTCC
>AF273413|IGHV5S9*01_Salsal|(F)|V-REGION
AGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAGCTGTACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF273417|IGHV5S9*02_Salsal|(F)|V-REGION
AGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGTTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAGCTGTACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTTGTTTA
>AF273416|IGHV5S9*03_Salsal|(F)|V-REGION
AGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGACAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAGCTGTACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGTA
>AF273411|IGHV5S9*04_Salsal|(F)|V-REGION
AGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAACTATACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGGG
>AF273414|IGHV5S9*05_Salsal|(F)|V-REGION
AGTCAGACATTGACTGAG......TCTGGACCA...GTGATTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAACTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAGCTGTACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF269077|IGHV5S9*06_Salsal|(F)|V-REGION
.....................................................................ACCTGTAAAG
TCTCTGGGTTCACATTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAGCTGTACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF269070|IGHV5S9*07_Salsal|(F)|V-REGION
..................................................................CTGTCCTGTACAG
TTTCTGGGTTCACATTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTATACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF269076|IGHV5S10*01_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTAGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTATGAGATGAGCTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATAGTTATAGT............ACTAATACATATTACTCACAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTATACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAC
>AF269071|IGHV5S10*02_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTAGTTAAAAAGTCTGGAGAATCCCACAAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTATGAGATGAGCTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATAGTTATAGT............ACTAATACATATTACTCACAGTCAGCCCAG...GGTAGATTTATC
ATCTCCAGAGATGACTCCAGCAGTAAGCTATACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GCTGGGGGCAA
>AF269075|IGHV5S10*03_Salsal|(F)|V-REGION
..................................................................CTGTCCTGTAAAG
CTTCTGGGTTCACATTC............AGTAGCTATGAGATGAGCTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATAGTTATAGT............ACTAATACATATTACTCACAGTCAGTCCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTATACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGGG
>AF273419|IGHV6S1*01_Salsal|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AGCTTACATACAGCTTGGATTCGACAACCTGCAGGGAAAACACTGGA
GTGGATTGGATATATCCATAGTGGT.........GGAAGCATGTATTATAAAGATAGTCTGAAG...AACAAGTTCAGC
ATCACCAGAGAGACTTCCAGCAACACGTTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCGC
>AF273420|IGHV6S1*02_Salsal|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AGCTTACATACAGCTTGGATTCGACAACCTGCAGGGAAAACACTGGA
GTGGATTGGATATATCCATAGTGGT.........GGAAGCATGTATTATAAAGATAGTCTGAAG...AACAAGTTCAGC
ATCACCAGAGAGACTTCCAGCAACACGTTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTACT
GTGCTCGT
>AF273421|IGHV6S1*03_Salsal|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AGCTTACATACAGCTTGGATTCGACAACCTGCAGGGAAAACACTGGA
GTGGTTTGGATATATCCATAGTGGT.........GGAAGCATGTATTATAAAGATAGTCTGAAG...AACAAGTTCAGC
ATCACCAGAGAGACTTCCAGCAACACGTTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTACT
GTGCTCGC
>AF273422|IGHV6S1*04_Salsal|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AGCTTACATACAGCTTGGATTCGACAACCTGCAGGAAAAACACTGGA
GTGGATTGGATATATCCATAGTGGT......GGAAGCATGTATTATAAAGATAGTCTGAAGAAC...AAGTTCAGCATC

>AF273426|IGHV6S2*01_Salsal|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCGTATTCAGTTACT...............AGCTTGTATACAGCTTGGATTCGACAGCCTGCAGGGAAAACACTGGA
GTGGATTGGATATATTAGTAGTGGT.........GGAAGCACAGCTTATAAAGATTCACTGAAA...AACAAGTTCAGC
ATCACCAGAGACACTTCCAGCAACACAGTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCGG
>AF273425|IGHV6S3*01_Salsal|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTTT...ATGACTGTCCAGTCAGGTCAACTACTGACCATCTCCTGTAAGG
TCTCATATTCTGTTACT...............AGTGTTGCTACATTCTGGATTCGACAGCCTGCAGGGAAAACATTGGA
GTGGATTGGATATATTAATAGTGGT.........GGAAGCACAGCTTATAAAGATTCACTGAAA...AACAAGTTCAGC
ATCACCAGAGACACTTCCAGCAACACATTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCGC
>AF273429|IGHV6S4*01_Salsal|(F)|V-REGION
...GAAGAACTCACTCAA......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCTGTAGGT...............AGCTATTACACAGCTTGGATTCGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAATATACT............GGAGGAACACACCACAAAGACTCCCTGAAA...AATAAGTTCAGC
CTCACTTTAGACTCCTCCAGCAATACTGTGACTTTAACAGGGCAGAACCTGCAGGCTGAAGACACAGCTGTGTATTATT
GTGCCAGA
>AF273432|IGHV6S5*01_Salsal|(F)|V-REGION
...TATGAACTCTCTCAG......CCAACATCT...ATGACTGTCCAGCCAGGTCAACCGCTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............GACACTTGGACATCTTGGATCCGACAGCCTGCAGGGAAAGCACTGGA
GTGGATTGGAAATGTATATTCT............GGAGACACAAAATACAAGGATTCTCTAAAG...AACAAGTTCAGC
CTGTCAGTAGACTCTAGCAGTAATACTGTGTTTTTAAAAGGGCAGAACCTTCAGACTGAAGACACAGCTGTGTATTATT
GTGCCTAC
>AF269085|IGHV6S5*02_Salsal|(F)|V-REGION
...TATGAACTCTCTCAG......CCAACATCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AACACTTGGACATCTTGGATCCGACAGCCTGCAGGGAAAGCACTGGA
GTGGATTGGAAATGTATATTCT............GGAGACACAAAATACAAGGATTCTCTAAAG...AACAAGTTCAGC
CTGTCAGTAGACTCAAGCAGTAATACTGTGTTTTTAAAAGGGCAGAACCTTCAGACTGAAGACACAGCTGTGTATTATT
GTGCCTTA
>AF273433|IGHV7S1*01_Salsal|(F)|V-REGION
GGACTTGAGTTCACCCAA......CCAAGCTCA...TTGGATGTAAAGCCTGGAGAGTCTTTGAGCATCACCTGTAAAG
TCTCTGGTTATTCTCTGACTGATAGCACCAACCTCCATGGAATAGGCTGGATCCGACATCCTACAGGAAAAGCACTTGA
ATGGATTTGGACCATCTATTATGAT.........GGAAGCTCAAACTCTCAAAGTTCCCTAAAA...GACAGGTTCAGT
TTCACAAGAGACACTTCCAGCAACACAGTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTACT
GTGCTCGG
>AF273435|IGHV8S1*01_Salsal|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCACTAATATGTACTGGATCCGCCAAGCAACTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAA.........GGTAGCAAGAGCAATGCCCAAGTAGTACAG...GGCAGATTCACA
GCGTCGAAGGAT......AGCTCTAACTTCTATCTGCACATGAACCTGTTGAAGTCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>AF273434|IGHV8S2*01_Salsal|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGGGGGATCCCTCAAACTCACATGTGCCT
GTAGTGGAATCACTCTA............AGCAGCAGTTATATGCACTGGTTCCGTCAGGCACCTGGAAAAGGACTTGA
ATGGATAATTTACTATTATTCTGAC.........AGTAACAAGAGCAATGCCCAGGTAGTACAG...GGCAGATTCACA
GCATCGAAGGAC......AGCTCTAATTTCTATCTGCACATGAGCCAGTTGAAGTCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>AF273436|IGHV9S1*01_Salsal|(F)|V-REGION
GGACAGTCACTCACCTCC......TCTGAGCCA...GTGGTGAAGAAACCTGGAGAGTCAGTAACACTGTCATGTACTG
TGTCTGGATTCTCCATG............GGTAGCTACAACATGCACTGGATCCGTCAGAAACCAGGGAAAGGTCTAGA
GTGGATTGGGCGTATTGACACTGGC.........ACTGGCACTATATTTGCCCAGTCCCTCCAG...GGCCAGTTCACC
ATCACCAAAGACAACTCTAAAAACCAGCTGTACTTAGAGGTGAAAAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>AF269086|IGHV11S1*01_Salsal|(F)|V-REGION
..............................GCT...CAACTCAAACCTCCTGGAGATTCAGTGAAACTCTCTTGCCAAA
TCTCTGGCTATGCCCTG............ACAGACTATGGTACAGTTTGGATACGACATGAGCCAGGGAAAACACTGGA
GTGGATTGGGATCATCTGGGGTGGT.........GGATCCATCAACTCTGGAGCCTCTTTTAAG...AGCAGATTCACC
ATCTCCAGAGAC...AGTAGTAATGTACTGTACTTAGACATCACCAGTCTGCAGGCTGAGGACACAGCTGTGTATTATT
GTGCAAAA
>AF094531|IGHV1S1*01_Treber|(F)|V-REGION
GGTCAGACACTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTTGCGAGTATGTATAACAGT.........GACAACATCTTCTACTCTGAGTCAGTGAAA...GGCCGGTTCTCC
ATCTCCAGAGACGACAACAGACAGCAGGTGTCTCTGCAGATGAGCAGTTTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGG
>AF303538|IGHV1S2*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTCTACATTGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTGCTTGATCACCTGATGGCA......GTAGCAGCATCTACTACCTTGAAGTCAAGTGAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303558|IGHV1S3*01_Treber|(F)|V-REGION
...........................................AAAGGCCTGGAGAATCTCACAGATTGACCTGTACGG
CCTCTGGATTCACATTC............AGTAGCTACTACATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTCGCTTTGATCCACCTGATGGCA...GTAGCAGCATCTACTACTCTGAGGTCAGTGGAA...GGGCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCACGA
>AF303540|IGHV1S4*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCCACTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCCGTTTGATCCACCCTACTAGCAGCAGTAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACATACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303555|IGHV1S5*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTACTACATGCACTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTATATCAGCAATGGCGGT...GGTGGCACCCAGTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACA
ATCTCCAGAGACAACAGCAGACAGCAGGTGTATCTGCAGATGAACAGTCTGAAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303565|IGHV1S6*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTACCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTTATCCACCCTTCTAGCAGCAGTGCCCACATCTATTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGCTGTATCTACAGATGAGCAGTGTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303563|IGHV1S7*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAACCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTGACTACAGGATGAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTTATCCACCCTACTAGC...AGTAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303550|IGHV1S8*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACATGTTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTACGAGATTAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTATTATCAGCAGTGGCAGT...GGTAGCACCAAGTACTACTCTGATTCAGTGAAA...GGCCGGTTCTCC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303566|IGHV1S8*02_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACATGTTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTACGAGATTAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTATTATCAGCAGTGGCAGT...GGTAGCACCAAGTACTACTCTGATTCAGTGAAA...GGCCGGTTCTCC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGGAGACTCTGCTGTGTATTACT
GTGCTCGA
>AF303561|IGHV1S9*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCCACTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGCAGCAATAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACATACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303564|IGHV1S10*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCCACTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGGTTGCTACTATCAGTGATAGC......AGTAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACATACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303562|IGHV1S11*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
GCTCTGGATTCACATTC............AGTAGCCACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGC...AGTAGCTACATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGGTGTCTCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303569|IGHV1S12*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTA............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303557|IGHV1S12*02_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACTG
CCTCTGGATTCACATTA............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGAATCGCTTGATCCACCCTACTAGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303573|IGHV1S12*03_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTA............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303567|IGHV1S12*04_Treber|(F)|V-REGION
...............................................................................
...........................................................GCTCCCGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303568|IGHV1S12*05_Treber|(F)|V-REGION
...............................................................................
...........................................................GCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303541|IGHV1S13*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACTA
CTTCTGGATTCACATTC............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCCGTTTGATCCACCCTACTACC...AGTAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
GGCTCCAAC...AACAACATACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303574|IGHV1S13*02_Treber|(F)|V-REGION
............ACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACTA
CTTCTGGATTCACATTC............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTACC...AGTAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
GGCTCCAGC...AACAACATACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303542|IGHV1S13*03_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACTA
CTTCTGGATACACATTC............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTGGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
GGCTCCAGC...AACAACATACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303552|IGHV1S14*01_Treber|(F)|V-REGION
...........................GAACCA...GTGACTAAAAGGCCGGGAGAATCTCACAGATTGACCTGTACTA
CTTCTGGATTCACATTC...............AACCACTACATTGCCTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACT......AGCAGGGCCAACATCTTCTACTCTGAGTCAGTG...AAAGGCCGGTTC
ATCGGCTCCAGCAACAACATACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303544|IGHV1S15*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
GGTCTGGATTCACATTC............AGTAGCCACTGGATGAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCCGTTTGATCCACTATAGCAGT...AGCTACATCTACTACTCTGAGTCAGTGAAAGGC...CGGTTCACCATC
TCCAGAGACAACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303556|IGHV1S16*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATCCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............ACTAGCTACTACATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTGGCTACTATCACCAATGGT......GGTAGCACCCCGTACTACTCTGAGTCATTTAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303560|IGHV1S16*02_Treber|(F)|V-REGION
...........................................................................ACAG
CCTCTGGATTCACATTC............ACTAGCTACTACATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTTGCTACTATCACCAATGGT......GGTAGCACCCCGTACTACTCTGAGTCATTTAAA...GGCCGGTTCACC
ATCTCCAGGGACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303553|IGHV1S17*01_Treber|(F)|V-REGION
..........................................AAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............ACTAGCTACAACATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGGTTACTTATATCAACACTGGT.........AGCACCCCGTACTACTTTGAGTCATTTAAA...GGCCGGTTCACC
ATTTCCAGAGACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGG
>AF303548|IGHV1S18*01_Treber|(F)|V-REGION
............ACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTGACTACTACATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTACG...AGTACGTACATCTCATCATCTGAGTCGAGTGAA...GGCCGGTTCACC
ATCTCCAGAGACAACACGAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303559|IGHV1S19*01_Treber|(F)|V-REGION
...............................................................................
.....ATTAAGTAG....................CTACTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCGCTTATAACGACAATGGC......GGTACCACCAAGTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303547|IGHV1S20*01_Treber|(F)|V-REGION
...............................................................................
...............................................................................
.............ATGGTA................GCAAACAGTTCTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303551|IGHV2S1*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATCCA...GTGACTAAAAGGCCCGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTACGGCATGAACTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTATATACATAGT............ACTTCTATCTATTACTCCCAGTCGGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAAGTGTATCTGCAGATGAACAGTCTGGAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303572|IGHV2S2*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATCCA...GTGACTAAAAGGCCCGGAGAATCTCACAGATTGACCTGTACAG
CTAGTGGATTTACATTCAGT.........CCCTACAGAGATGAAGCATGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTATATCAGCACAGCT......AGTAGTCCGATCTATTACTCCCAGTCGGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAAGTGTATCTGCAGATGAACAGTCTGAAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303534|IGHV2S3*01_Treber|(F)|V-REGION
...................................................GGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTGACTACTACATGCACTGGATCAGACAGGCTCCTGGAAAAGGATTGGA
GTGGATCGCTATTATCGGCACAAGC......AGTTCTCCGATCCGTTACTCCCAGTCGGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCAGCAGTAAAAAAGTATCTGCAGATGAACAGTCTGAAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303539|IGHV2S4*01_Treber|(F)|V-REGION
...............................................................................
.........................................ATGAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTTATACACACAGGC......AGTACTTCTACCTCTTACTCCCAGTCGGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAAGTGTATCTGCAGATGAACAGTCTGAAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303554|IGHV2S4*02_Treber|(F)|V-REGION
...............................................................................
.........................................ATGAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTTATACACACAGGC......AGTACTTCTACCTCTTACTCCCAGTCGGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAAGTGTATCTGCAGATGAACAGTCTGAAGGCTGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303571|IGHV3S1*01_Treber|(F)|V-REGION
TGTGAGCAGTTGATACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGCCCATCACCTGTCAGG
TCTCTTATTCTGTTAGC...............AGCTACAACACAGCCTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATAGGAATGGCAGCTGCTGGA.........TCCACCACACACTTTAAAGATTCACTGAAG...AGCAAGTTCAGT
ATCGACTTAGACTCTTCCAGCAAAACAGTGACTCTGAACGGACAGAGCATGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AF303570|IGHV3S2*01_Treber|(F)|V-REGION
............ATACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATTCTGTTAGC...............AGCTACTACACAGCCTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATAGGAATGAGACAAGGT............TCAACTACATACTACAAAGATTCACTGAAG...AGCAAGTTCAGT
ATCGACTTAGACTCTTCCAGCAAAACAGTGACTCTGAACGGACAGAGCGTGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AF303537|IGHV3S3*01_Treber|(F)|V-REGION
TGTGAGCAGTTGATACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATTCTGTTAGC...............AGCGCCTACACAGCCTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATAGGAATGAAATACACA............AGTGGTACACACTACAAAGATTCACTGAAG...AGCAAGTTCAGC
ATCGACTTAGACTCTTCCAGCAACACAGTGACTCTGAACGGACAGAGCGTGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AF303543|IGHV3S4*01_Treber|(F)|V-REGION
TGTGAGCAGTTGACACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATCTGTGG..................CAGTCATCATACCATTGGATCAGACAGCCTGCAGGAAAAGGACTGGA
GTGGATATCGCGCACGTGGTTGGAT.........ACTCCACAGTCCGAAAAAGATTCACTGAAG...AGCAAGTTCAGT
ATCGACTTAGACTCTTCCAGCAACACAGTGACTCTGAACGGACAGAGCATGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AF303535|IGHV3S5*01_Treber|(F)|V-REGION
TGTGAGCAGTTGATACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATTCTCTT..................GGCTCCTTCACAGCCTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATAGGCGTGAAACACTGG...............AGTTCATCATACAAAGATTCACTGAAG...ACGAAGTTCAGT
ATCGACTTAGACTCTTCCAGCAACACAGTGACTCTGAACGGACAGAGCGTGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AF108421|IGHV1S1*01_Takrub|F|V-REGION
GCTCAGACTCTGACCCAG......TCTGAACCA...GTGGTTAAAAGACCTGGAGAATCTCACACACTGACCTGTTCAG
CCTCTGGATTCACATTC............AGCAGCTACTGGATGGCCTGGATCAGACAGGTTCCTGGAAAAGGACTGGA
GTGGATCGCTTATATTGGCACCAGT......AGCAGCCCTAAGTACTACTCTGAGTCAGTCAAA...GGCCGGTTTATC
ATCTCCAGAGACGACAACAGAGCACAGCTGAATCTGCAGATGAACAGCCTGAAGACGGAAGATTCTGCTGTTTATTATT
GTGCTCGATGGT
>AF108421|IGHV1S2*01_Takrub|F|V-REGION
GCTCAGACTCTGACCCAG......TCTGAACCA...GTGGTTAAAAGACCTGGAGAATCTCACACACTGACCTGTTCAG
CCTCTGGATTCACATTC............AGCAGCTATGAGATGAACTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCGCATATATCTACAGGAGT......GGCAGCAGCCAGTACTACTCTGAGTCAGTCAAA...GGCCGGTTTATC
ATCTCCAGAGACAACAACAGAGCACAGCTGAATCTGCAGATGAACAGCCTGAAGACTGAAGATTCTGCTGTTTATTATT
GTGCTCGAGAGT
>AF108421|IGHV1S3*01_Takrub|F|V-REGION
GCTCAGACTCTGACCCAG......TCTGAACCA...GTGGTTAAAAGACCTGGAGAATCTCACACACTGACCTGTTCAG
CCTCTGGATTCACATTC............AGCAGCTATGAGATGAACTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCGCTTATATCAGCAGCAGT......AGCAGCTACAAGTACTACTCTGAGTCAGTCAAA...GGCCGGTTTCTC
ATCTCCAGAGACGACAACAGAGCACAGCTGAATCTGCAGATGAACAGCCTGAAGACTGAAGATTCTGCTGTTTATTATT
GTGCTCGAGAGT
>AF108422|IGHV1S4*01_Takrub|F|V-REGION
GCTCAGACTCTGACCCAG......TCTGAACCA...GTGGTTAAAAGACCTGGAGAATCTCACACACTGACCTGTTCAG
CCTCTGGATTCACATTC............AGCAGCTACTGGATGCACTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCAGTGCTATCAGCACTGGC.........AGCAGCCAGTACTACTCTGAGTCAGTCAAA...GGCCGGTTTATC
ATCTCCAGAGACAACAACAGAGCACAGCTGAATCTGCAGATGAACAGCCTGAAGACTGAAGATTCTGCTGTTTATTATT
GTGCTCGATGGT
>AF108423|IGHV1S5*01_Takrub|F|V-REGION
GCTCAGACTCTGACCCAG......TCTGAACCA...GTGGTTAAAAGACCTGGAGAATCTCACACACTGACCTGTTCAG
CCTCTGGATTCACATTC............AGCAGCTATGGGATGCACTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCAGTCTCATTTACTATGAT......GGCAGCAACAAGTACTACTCTGAGTCAGTCAAA...GGCCGGTTTCTC
ATCTCCAGAGACAACAACAGAGCACAGCTGAATCTGCAGATGAACAGCCTGAAGACTGAAGATTCTGCTGTTTATTATT
GTGCTCGAGAGT
>AF108421|IGHV2S1*01_Takrub|ORF|V-REGION
GGTGAACAGTTGACACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAGAGTCTGACCATCACCTGTCAGG
TCTCTTATTCTCTCAGC...............AGCTACTGGACACACTGGATCAGACAGCCTCCAAGGAAAGGACTGGA
GTGGATTGGATGGAAATATACT............GGAGGCTCCTACTACAAAGATTCCCTGAAG...AACAAGTTCAGC
ATCAGTTTAGACTCTTCCAGCAACACAGTGACTCTAAATGGAGTGAATGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCGGA
>AF108421|IGHV2S2*01_Takrub|ORF|V-REGION
TGTGAACAGTTGACACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAGCGTCTGACCATCACCTGTCAGG
TCTCTTATTCTGTTAGC...............AGCTATTACACAAGCTGGATCAGACAGCCAGCAGGGAAAGGACTGGA
GTGGATTGGGTGGAATAGTGTTGGA.........TCCACCCCACGCTACAAAGCTTCCCTGAAG...AACAAGTTCAGC
ATCAGTTTGGACTCTTCCAGCAACACAGTGACTCTAAATGGAGTGAATGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGA
>AF108423|IGHV2S3*01_Takrub|ORF|V-REGION
TGTGAACAGTTGACACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAGAGTCTGACAATCACCTGTCAGG
TCTCTTATTCTGTTAGC...............AGCTACTGGACAGGCTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAAATGGTGTTGGA............TCTAGCACATATTATAAAGCTTCCCTGAAG...AACAAGTTCAGC
ATCAGTTTGGACTCTTCCAGCAACACAGTGACTCTAAATGGAGTGAATGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGATA
>AF108422|IGHV2S4*01_Takrub|ORF|V-REGION
...............................................................................
...............................................................................
.............TAA.......................ATGGAGTGAATGTGCAGCCTGAAGA...CACTGCTGTGTA
TTACTGTGCCAGATA
>AF437736|IGHV1S1*01_Chaace|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACACATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTGGCTCCTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATTGCCACTATCAGCACAAGC......AGTAGCAGCATCTTCTACTCTGAGTCATTTAAA...GGCCGCTTCACC
ATCTCCAGAGACGACAACCACCAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGAGAC
>AF437737|IGHV1S2*01_Chaace|(F)|V-REGION
...............................................................................
..TCTGGATTCACATTC............AGTAGCTACGGCATGCACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTATTTCGACACTGGG.........AGCACCGCATACTACTCTGAGTCATTTAAA...GGCCGCTTCACC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGTATA
>AF437738|IGHV1S1*01_Notcor|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTCCTACATGAACTGGGTCAGACAGGCTGCTGGGAAAGGACTGGA
GTGGATCGCTTATATCTACCCTAGC......AGTAGCACCGTGTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGAGTC
>AF437739|IGHV1S2*01_Notcor|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGAGTTGACTTT............GGTAGCTCTTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTTGCGATTATTGAACATGAT......AGTGATCGTATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGAGAACAACAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGGGCG
>AF437740|IGHV1S3*01_Notcor|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCCACTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGGTTGCTATTATGCACCCTACTAGC...AGTGCCCACATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGGTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGAGAA
>AF437741|IGHV1S4*01_Notcor|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGACCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCATCTACATGGCCTGGATCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCGCTTATATCGGCACAAGC......AGTTCTCCTATATCTTACTCCCAGTCGGTTCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAAATGTATCTGCAGATGAACAGTCTGAAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGATGG





Created: 29/06/1999
Last modified: 22/07/2008


-> IMGT/V-QUEST Search page
-> IMGT Repertoire
-> IMGT Scientific chart
-> IMGT Home page

© Copyright 1995-2017 IMGT, the international ImMunoGeneTics database