IMGT reference directory: J-REGION Sheep IGHJ set

The IMGT reference directory contains sets of allele sequences isolated from the IMGT reference sequences. By definition, these sets contain one sequence for each allele.

Authors: Véronique Giudicelli (Veronique.Giudicelli@igh.cnrs.fr) and Marie-Paule Lefranc (Marie-Paule.Lefranc@igh.cnrs.fr)

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® http://www.imgt.org (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209 Full text Cover; Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219 Full text; Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207 Full text; Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085 Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056 Full text.
For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.

>Z71572_IGHHJ1*01(P)
TATGCTGACTTCCATCTCTGGGACCAGGGTGCCCTGGTCACCGTCTCCTCA
>Z71572_IGHHJ2*01(P)
TGCTGGGACTCGGGTCTCTGGGGCCAGCGCACCCCGGTCACCGTGTCCTTG
>Z71572_IGHHJ3*01(ORF)
GCTTTTGACTCCTGGGGCCAGCGCGCCCCGGTCACAGTCTCCTCAG
>Z71572_IGHHJ4*01(F)
TATATCGACTACTGGGGCCCAGGACTCCTGGTCACCGTCTCCTCAG
>Z71572_IGHHJ5*01(ORF)
GACTGGCTCAAGCACTGGGGCCAGGGACCCCGACGCTGTCTGCTC
>Z71572_IGHHJ6*01(F)
TACTACGGTGTAGATGTCTGGGGCCGAGGACTCCTGGTCACCGTCTCCTCAG

Created: 13/11/2002
Last modified: 3/06/2004

-> IMGT/V-QUEST Search page
-> IMGT Repertoire
-> IMGT Scientific chart
-> IMGT Home page