| IMGT/PRIMER-DB Primer accession number | IPP201000 |
| IMGT/PRIMER-DB entry date | 22/10/2003 |
| IMGT/PRIMER-DB update | 27/10/2003 |
| IMGT/PRIMER-DB Primer definition | Homo sapiens IGHG1*01 Antisense primer Antisense |
| Primer alias name | CG1z |
| Bibliographic references (PubMed) |
PMID: 1826052 |
| Catalogue comments | IGHG1 gene specific |
| IMGT/PRIMER-DB Primer sequence | 30 pb; 7 A; 4 C; 8 G; 11 T; 0 other 5' GCATGTCTAGTTTTGTCACAAGATTTGGG 3' |
| IMGT/PRIMER-DB Sequence length (number of nucleotides) | 30 |
| IMGT/PRIMER-DB Primer orientation | Antisense |
| IMGT/LIGM-DB reference sequence Accession number |
J00228 |
| IMGT/LIGM-DB reference sequence Primer position (start-end) |
894-923 |
| Primer Localization |
...CAGGCACAGGCTAGGTGCCCCTAACC 720 |
|
|
| Characteristics comments | IGHG1*01 Allele chosen as a representative of the IGHG1 Gene |
| IMGT/PRIMER-DB Set | IPS000034 |
| IMGT/LIGM-DB reference sequence Classification |
Species | Homo sapiens |
| IMGT group | IGHC | |
| IMGT subgroup | ||
| IMGT gene name | IGHG1 | |
| IMGT allele name | IGHG1*01 | |
| Classification comments and specificity | ||
| IMGT/PRIMER-DB Primer labels |
|
||||||||||||
| Differences between the IMGT/LIGM-DB reference sequence and the primer sequence |
Modified: G7 is replaced by A7 in primer sequence Modified: T8 is replaced by C8 in primer sequence Modified: G9 is replaced by T9 in primer sequence, |
||||||||||||
| Restriction enzyme name | ACTAGT SpeI | ||||||||||||
| Restriction site position | 7-12 | ||||||||||||
| Purification methods | |||||||||||||
| Keywords | |||||||||||||
| Description comments | |||||||||||||