IMGT/PRIMER-DB Primer accession number | IPP700013 |
IMGT/PRIMER-DB entry date | 05/11/2003 |
IMGT/PRIMER-DB update | 05/11/2003 |
IMGT/PRIMER-DB Primer definition | Homo sapiens IGKV2-29*01 Sense primer Sense |
Primer alias name | AF90 |
Bibliographic references (PubMed) |
PMID: 8662073 |
Catalogue comments | IGKV2-29 gene specific |
IMGT/PRIMER-DB Primer sequence | 26 pb; 8 A; 8 C; 2 G; 8 T; 0 other 5' CATTAGCTTTCACATAACCTTGCAC 3' |
IMGT/PRIMER-DB Sequence length (number of nucleotides) | 26 |
IMGT/PRIMER-DB Primer orientation | Sense |
IMGT/LIGM-DB reference sequence Accession number |
X63396 |
IMGT/LIGM-DB reference sequence Primer position (start-end) |
693-718 |
Primer Localization |
...AATTCATATTTTGCCCTGATGATGATTTGAAAACTCCTAAAAGCAGT 540 |
Characteristics comments | IGKV2-29*01 Allele chosen as a representative of the IGKV2-29 Gene |
IMGT/PRIMER-DB Set | IPS000045 |
IMGT/LIGM-DB reference sequence Classification |
Species | Homo sapiens |
IMGT group | IGKV | |
IMGT subgroup | IGKV2 | |
IMGT gene name | IGKV2-29 | |
IMGT allele name | IGKV2-29*01 | |
Classification comments and specificity | IGKV2-29*01 is a pseudogene |
IMGT/PRIMER-DB Primer labels |
|
||||||
Differences between the IMGT/LIGM-DB reference sequence and the primer sequence |
Modified: T6 is replaced by A6 in primer sequence | ||||||
Restriction enzyme name | |||||||
Restriction site position | |||||||
Purification methods | |||||||
Keywords | |||||||
Description comments |