IMGT/PRIMER-DB Primer accession number | IPP800001 |
IMGT/PRIMER-DB entry date | 21/11/2003 |
IMGT/PRIMER-DB update | 24/11/2003 |
IMGT/PRIMER-DB Primer definition | Homo sapiens IGKV2D-29*01 Sense primer Sense |
Primer alias name | AF103 |
Bibliographic references (PubMed) |
PMID: 11261927 |
Catalogue comments | IGKV2D-29 gene specific |
IMGT/PRIMER-DB Primer sequence | 27 pb; 8 A; 2 C; 6 G; 11 T; 0 other 5' TATTTAACTTGGGTTCATTTAAAGAG 3' |
IMGT/PRIMER-DB Sequence length (number of nucleotides) | 27 |
IMGT/PRIMER-DB Primer orientation | Sense |
IMGT/LIGM-DB reference sequence Accession number |
M31952 |
IMGT/LIGM-DB reference sequence Primer position (start-end) |
584-610 |
Primer Localization |
...GGAGATGAGGGAGGAGGAGGGGGTGGGAAGCTGAGC 420 |
|
|
Characteristics comments | IGKV2D-29*01 Allele chosen as a representative of the IGKV2D-29 Gene |
IMGT/PRIMER-DB Set | IPS000122 |
IMGT/LIGM-DB reference sequence Classification |
Species | Homo sapiens |
IMGT group | IGKV | |
IMGT subgroup | IGKV2 | |
IMGT gene name | IGKV2D-29 | |
IMGT allele name | IGKV2D-29*01 | |
Classification comments and specificity | AF103 and AF68 for IGKV2D-29 allele determination by PCR and restriction enzyme mapping |
IMGT/PRIMER-DB Primer labels |
|
|||||||||
Differences between the IMGT/LIGM-DB reference sequence and the primer sequence |
Modified: T8 is replaced by G8 in primer sequence Modified: A9 is replaced by C9 in primer sequence Modified: A10 is replaced by T10 in primer sequence Modified: A11 is replaced by T11 in primer sequence |
|||||||||
Restriction enzyme name | ||||||||||
Restriction site position | ||||||||||
Purification methods | ||||||||||
Keywords | ||||||||||
Description comments |