Citing IMGT/V-QUEST:
Brochet, X., Lefranc, M.-P. and Giudicelli, V. Nucl. Acids Res. 36, W503-508 (2008). PMID: 18503082.
Giudicelli, V., Brochet, X., Lefranc, M.-P. Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.prot5633. doi: 10.1101/pdb.prot5633.
PMID: 21632778 Abstract also in IMGT booklet with generous provision from Cold Spring Harbor (CSH) Protocols (high res) (lower res)

IMGT/V-QUEST program version: 3.7.0 (21 July 2025) - IMGT/V-QUEST reference directory release: 202531-1 (28 July 2025)

Introduction

IMGT/V-QUEST (V-QUEry and STandardization) [1, 12] at Montpellier is an integrated alignment tool for the immunoglobulin (IG) and T cell receptor (TR) nucleotide sequences. IMGT/V-QUEST compares your germline or rearranged IG or TR variable sequences with the IMGT/V-QUEST reference directory sets.

The IMGT/V-QUEST ouput displays are according to the IMGT Scientific chart rules and IMGT Repertoire .

Note that :

Sets of sequences to test IMGT/V-QUEST functionalities

IMGT/V-QUEST reference directory sets

IMGT/V-QUEST selection and input

IMGT/V-QUEST is available from the IMGT Home page for IG and TR rearranged sequences of different species.

The Search page includes five sections :

IMGT/V-QUEST output

The IMGT/V-QUEST output is described below.

If, instead of the IMGT/V-QUEST output, "no results" is displayed, this may correspond:
- either to sequences with an absent or too short V-REGION not analysed by the tool.
- or to the nonavailability of a given locus reference directory following a selection on the "IG" or "TR" receptor type.

A. Detailed view

Top of the IMGT/V-QUEST result page

The top of the IMGT/V-QUEST result page indicates:

- the IMGT/V-QUEST programme version,
- the IMGT/V-QUEST reference directory release

It recalls the parameters selected in the IMGT/V-QUEST Search page:

- Species: for example, Homo sapiens
- Receptor type or locus: IG, IGH, IGL, IGI, TR, TRA, TRB, TRG, or TRD
- IMGT reference directory set: for example, F+ORF+in-frame P (by default)
- Search for insertions and deletions: yes or no
- The "Nb of nucleotides to add (or exclude) in 3' of the V-REGION for the evaluation of the alignment score" and "Nb of nucleotides to exclude in 5' of the V-REGION for the evaluation of the nb of mutations" are indicated if default values have been modified in the Search page.
- The "Analysis of single chain Fragment variable (scFv)" is indicated if the option is selected

The number of analysed sequences is displayed with the list.
The name of each sequence is directly linked to its corresponding results.

For each analysed sequence, its length, the Sequence analysis category (see IMGT/V-QUEST annexes ) and the IMGT reference directory set used for the alignments (for example, human IG set) are indicated.
The sequence is displayed in FASTA format.
The delimitation of the V-DOMAIN identified and analysed by IMGT/V-QUEST is highlighted in green.

If an input sequence was provided in the antisense orientation, IMGT/V-QUEST complementary reverses it automatically, and the results will be shown on the complementary reverse sequence (that is in "sense" orientation for the V-GENE).

Result summary

A summary of the results is provided as a table. The Result summary table provides:

Note for the display of warnings if any: the letters between parenthesis appear in the order that the warnings are detected.

Results

The results may include (if selected in the input page):

  1. Alignment for V-GENE and allele identification
  2. Alignment for D-GENE and allele identification
  3. Alignment for J-GENE and allele identification
  4. Results of IMGT/JunctionAnalysis
  5. Sequence of the JUNCTION ('nt' and 'AA')
  6. V-REGION alignment
  7. V-REGION translation
  8. V-REGION protein display
  9. V-REGION mutation and AA change table
  10. V-REGION mutation and AA change statistics
  11. V-REGION mutation hotspots
  12. Sequences of V-, V-J- or V-D-J- REGION ('nt' and 'AA') with gaps in FASTA.
  13. Annotations by IMGT/Automat
  14. IMGT Collier de Perles

Note that sequence names longer than 35 characters are truncated in the alignments and in the Results of IMGT/JunctionAnalysis.

Example : the sequence of AF184762 accession number.

  1. Alignment for V-GENE and allele identification


    This alignment shows your sequence aligned with the closest V-REGION alleles from the IMGT/V-QUEST reference directory sets. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering or nucleotides that are not taken into account for the alignments.

    • The gene and allele functionality is indicated.

    • The alignment score is calculated by counting +5 for each nucleotide match and -4 for each mismatch. The score allows to emphasize differences between the IMGT reference directory sequences and the input sequence, since a single nucleotide mismatch corresponds to a difference of 9 in the score.

    • The alignment score is calculated from the 5' end of the V-REGION up to a codon position in 3' defined according to the locus ( see the default values") in order to avoid counting nucleotides from N diversity and then, in a second step, it is adjusted to take into account the nt of the rearranged of the 3'V-REGION.

    • For each alignment, the score and the percentage of nucleotide identity are indicated. The number of identical nucleotides and the total number of nucleotides (excluding gaps) used for this evaluation are indicated between parentheses.

  2. Alignment for D-GENE and allele identification

    If this option has been selected in the query page, this alignment shows your sequence aligned with the closest D-REGION alleles from the IMGT/V-QUEST reference directory sets. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering or nucleotides that are not taken into account for the alignments.

    • The score is calculated by counting +5 for each nucleotide match and -4 for each mismatch. The score allows to emphasize differences between the IMGT reference directory sequences and the input sequence, since a single nucleotide mismatch corresponds to a difference of 9 in the score.

    • For each alignment, the score and the percentage of nucleotide identity are indicated. The number of identical nucleotides and the total number of nucleotides (excluding gaps) used for this evaluation are indicated between parentheses.

    • The alignments for the D-REGION and the J-REGION start from the end of the V-REGION.

    • The "Alignment for D-GENE and allele identification" provided by IMGT/V-QUEST may show discrepancies with the results obtained by IMGT/JunctionAnalysis as the way to identify the D-REGIONs is different between the two tools [1,3,4,5]. In case of discrepancies, the results of IMGT/JunctionAnalysis are the most accurate [4,5].
      However, the alignment provided by IMGT/V-QUEST may be useful in some cases for extensive comparison.

  3. Alignment for J-GENE and allele identification .
    This alignment shows your sequence aligned with the closest J-REGION alleles from the IMGT/V-QUEST reference directory sets. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering or nucleotides that are not taken into account for the alignments.

    • The score is calculated by counting +5 for each nucleotide match and -4 for each mismatch. The score allows to emphasize differences between the IMGT reference directory sequences and the input sequence, since a single nucleotide mismatch corresponds to a difference of 9 in the score.

    • For each alignment, the score and the percentage of nucleotide identity are indicated. The number of identical nucleotides and the total number of nucleotides (excluding gaps) used for this evaluation are indicated between parentheses.


  4. Results of IMGT/JunctionAnalysis.

    Depending on the selection you made in the IMGT/V-QUEST input page, and depending on your sequence, the results of IMGT/JunctionAnalysis [4] or the translation of the JUNCTION will be displayed.

    • A JUNCTION will extend from 2nd-CYS 104 to J-PHE or J-TRP included. J-PHE or J-TRP are easily identified when the conserved Phe/Trp-Gly-X-Gly motif of the J-REGION is present. The translation is displayed up to the motif (not included) if the motif is present in your sequence or in the closest J-REGION, or up to the end of your sequence if the motif is not found.

    • Analysis of the JUNCTION and Translation of the JUNCTION

      If the option "Includes IMGT/JunctionAnalysis" is selected, the results from IMGT/JunctionAnalysis are displayed.

      • By default, only one D-GENE is searched in the IGH junctions, one in the TRB junctions and three in the TRD junctions. You are allowed to modify this value in input options (Nb of D-GENE in IGH (or TRB or TRD) JUNCTIONs) of the IMGT/V-QUEST query page.

      • The results of IMGT/JunctionAnalysis are detailed in IMGT/JunctionAnalysis documentation:
        - Analysis of the JUNCTION
        - JUNCTION alignments with translation and IMGT AA classes

      • The number of accepted mutations in 3'V-REGION, D-REGION, and 5'J-REGION corresponds to the default values indicated in IMGT/JunctionAnalysis documentation except for unmutated IG V-GENE (no mutations in FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT and FR3-IMGT). In this case, the number of accepted mutations is:
        - 0 in 3'V-REGION and 5'J-REGION, and 2 in D-REGION of IGH sequences
        - 2 in 3'V-REGION and 5'J-REGION of IGK and IGL sequences

      The IMGT/JunctionAnalysis results are shown in the figure:

      JUNCTION amino acid are colored according to the IMGT amino acid classes for chemical characteristics [8].

    • Eligible D-GENE

      This option "with full list of eligible D-GENE" is not selected by default in the IMGT/V-QUEST query page. If selected, IMGT/JunctionAnalysis displays all eligible D-GENE and alleles with the length of the germline D-REGION, the sequence identified in the JUNCTION (hyphens indicate similarity), the alignment score and the number of mutations. The column on the right side indicates the location of the aligned nucleotides in the D-REGION (for example d[3-8]), and the location of the aligned nucleotides in the JUNCTION (for example s[22-27]);

    Note that IMGT/JunctionAnalysis gives no results when:
    • The D gene and allele reference directory of the IGH, TRB or TRD analysed sequences is not managed in IMGT/GENE-DB .
    • The sequence of the 3'V-REGION of the V gene and allele or/and of the 5'J-REGION of the J gene and allele are not well delimitated (for example in case of partial reference sequences and of reference sequences from cDNA).
    • The number of mutations in the 3'V-REGION, D-REGION, and /or J-REGION is higher than the number set in the "Parameters for IMGT/JunctionAnalysis".

    If, in the current conditions, IMGT/JunctionAnalysis is unable to provide a result, the sequence of the JUNCTION is shown (see below). as well as the JUNCTION nucleotide sequence formatted for the IMGT/JunctionAnalysis tool.

  5. Sequence of the JUNCTION ('nt' and 'AA')

    The sequence of the JUNCTION is diplayed in nucleotide and in amino acid with the IMGT unique numbering.

    Sequence of the JUNCTION ('nt' and 'AA') displays the sequence of the JUNCTION and its translation, independently of its analysis by IMGT/JunctionAnalysis, as it is in the sequence analysed by IMGT/V-QUEST. If the option 'Search for insertions and deletions in V-REGION' has been selected, the deletions identified in the 3'V-REGION are shown as gaps and the insertions identified in the 3'V-REGION are deleted. The 3'V-REGION is translated accordingly and the translation is then continued in the 3' part without any other modification.

  6. V-REGION alignment according to the IMGT unique numbering

    The sequences are shown with the IMGT unique numbering and with the IMGT framework region ( FR-IMGT) and complementarity determining region ( CDR-IMGT) delimitations. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering.




    The resulting alignment shows the CDR3-IMGT of the germline V-REGION alleles of the IMGT reference directory sets. The CDR3-IMGT of the input rearranged sequence has to be identified in the translation of the JUNCTION (see above).
    The correct amino acid numbering of the rearranged CDR3-IMGT is the one shown in the Results of IMGT/JunctionAnalysis or translation of the JUNCTION

  7. V-REGION translation

    The "Translation of the input sequence" shows the nucleotide sequence and deduced amino acid translation of the input sequence, aligned with the V-REGION of the closest germline V-GENE, and with the FR-IMGT and CDR-IMGT delimitations.
    The 3' limit of the CDR3-IMGT of the input rearranged sequence is correctly identified if the conserved Phe/Trp-Gly-X-Gly motif of the J-REGION has been identified. If not, the 3' limit of the CDR3-IMGT needs to be checked
    The correct amino acid numbering of the rearranged CDR3-IMGT is the one shown in the Results of IMGT/JunctionAnalysis or translation of the JUNCTION




  8. V-REGION protein display.

    The "V-REGION protein display" shows the deduced amino acid translation of the input sequence, aligned with the V-REGION of the closest germline V-GENE, and with the FR-IMGT and CDR-IMGT delimitations.
    On the third line of the alignment are shown in bold, the input sequence amino acids which different from the closest germline.




  9. V-REGION mutation and AA change table

    The "V-REGION mutation and AA change table" shows the mutations of the input sequence by comparison with the V-REGION of the closest germline V-GENE. Mutations are described according to the IMGT Scientific chart rules and according to the IMGT unique numbering for V-REGION. Mutations are shown for FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT and for the part of the CDR3-IMGT which can be compared with the V-REGION .

    IMGT mutation and AA change description

    IMGT mutations and AA changes are described as follows:

    Nonsilent mutation: mutation with AA change

    If the mutation is nonsilent, the nucleotide mutation is described, followed by a comma and the corresponding amino acid change: "t88>c, F30>L" means that the nucleotide "t" at position 88 of the V-REGION of the closest germline V-GENE has been mutated to "c" ("t88>c") and that the amino acid "F" at position 30 has been changed to "L" ("F30>L").
    For each amino acid change, the IMGT amino acid classes [8] that are conserved despite the amino acid change are indicated with "+" between parentheses in the following order: hydropathy, volume, chemical characteristics. For example, F30>L (+ - -) indicates that the two amino acids, F and L, belongs to the same hydropathy class but that the volume and the chemical characteristics classes are different.

    The AA changes are qualified as:

    • Very similar: (+ + +)
    • Similar: (+ + -) or (+ - +)
    • Dissimilar: (+ - -) or (- + -) or (- - +)
    • Very dissimilar: (- - -)

    As a consequence, two compared AA are qualified as:

    • Identical
    • Very similar
    • Similar
    • Dissimilar
    • Very dissimilar

    Silent mutation: mutation without AA change

    If the mutation is silent, the amino acid is identical in the V-REGION of the closest germline V-GENE and in the mutated sequence. Therefore the field on AA change (">" ) and IMGT amino acid classes changes are not shown: "g36>a, L12" means that the nucleotide "g" at position 36 of the V-REGION of the closest germline V-GENE has been mutated to "a" ("g36>a") and that the amino acid "L" at position 12 is unchanged in the mutated sequence ("L12").

    IMGT note: No amino acid is indicated if the mutated nucleotide is not in a codon (for example, "a320>g" at the end of the CDR3-IMGT)




  10. V-REGION mutation and AA change statistics

    The "V-REGION mutation and AA change statistics" shows the number of mutations and amino acid changes, by comparison with the V-REGION of the closest germline V-GENE. Numbers of mutations and amino acid changes are shown for the whole V-REGION, the FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT and the part of the CDR3-IMGT which can be compared with the V-REGION.

    Note that the number of mutations for the V-REGION and the CDR3-IMGT are calculated with the 3' end delimitation determined by IMGT/JunctionAnalysis. Numbers added between parentheses for the V-REGION and the CDR3-IMGT indicate the number of nucleotide differences without taking into account the shortening of the V-REGION. These numbers include nucleotide differences that result from the N-diversity.

    Nucleotides : the number of silent and nonsilent mutations is evaluated, as well as each type of transition and transversion.
    Amino acids : The number of identical AA and AA changes is evaluated as well as each type of AA changes.



  11. V-REGION mutation hotspots

    • Hotspots motifs and localizations in germline V-REGION
      The motifs, the positions and the FR-IMGT or CDR-IMGT localization of hotspots within the closest germline V-REGION are listed.
      Searched hotspot motifs (with mutated nucleotides underlined) include:

      - (a/t)a or wa
      - t(a/t) or tw
      - (a/g)g(c/t)(a/t) or rgyw
      - (a/t)(a/g)c(c/t) or wrcy

      Where w= a or t (a/t), r= a or g (a/g), y= c or t (c/t) (IMGT Scientific chart > Uncertain nucleotides)



    • Correlation between V-REGION mutations, AA changes, codons changes and hotspots motifs
      The table includes the description of each V-REGION mutation and AA change as described in 9.V-REGION mutation and AA change table and, separated by a semi-colon, the following:

      - the amino acid in the closest germline V-REGION with its codon and positions and the corresponding hotspot motif(s) between brackets if any (all this information is from the closest germline V-REGION),
      - the sign ">",
      - the amino acid in the analysed mutated sequence with its codon (if the mutation is silent, the AA is unchanged).

      For example in: "t88>c, F30>L (+ - -); F30 ttc 88-90 [tt 88-89]>L ctc"

      "F30 ttc 88-90 [tt 88-89]>L ctc" means that the amino acid "F" at position "30" in the closest germline amino acid V-REGION is encoded by the codon "ttc" at positions "88-90" which corresponds to the hotspot "[tt 88-89]" (motif "tt" at positions "88-89"). Owing to the mutation, the "F30 ttc" is changed (">") to "L ctc".

       



  12. Sequences of V-, V-J- or V-D-J- REGION ('nt' and 'AA') with gaps in FASTA and access to IMGT/PhyloGene for V-REGION ('nt')

    The sequences of the V-, V-J- or V-D-J- REGION (in nucleotides ('nt') and in amino acids ('AA')) are displayed, in FASTA format, with gaps according to the IMGT unique numbering. Amino acid sequences are also displayed on one line.




    Note that the V-J- or V-D-J- REGION amino acid sequences are shown in red for unproductive sequences with an out-of-frame junction.

    Note that if the V-J- or V-D-J- REGION amino acid sequences are used in the IMGT/Collier-de-Perles tool online, the CDR3-IMGT length needs to be indicated in the appropriate window. For information, gaps of CDR3-IMGT shorter than 13 amino acids are not shown in the V-J- or V-D-J- REGION in FASTA format or on one line.

  13. Annotation by IMGT/Automat

    The annotation of the V-REGION, V-J-REGION and /or V-D-J-REGION of the input sequence is provided by IMGT/Automat [9].



  14. IMGT Collier de Perles for the input sequence V-DOMAIN

    The following information is provided:
    • the region identified by IMGT/QUEST
    • the CDR-IMGT lengths
    • the FR-IMGT lengths
    The CDR-IMGT and FR-IMGT lengths are based on the IMGT unique numbering for V-DOMAIN.

    By default, the link to the IMGT/Collier-de-Perles tool is provided.



    Clicking on the link provides access to the IMGT Collier de Perles generated by the IMGT/Collier-de-Perles tool program (originally developed by Gérard Mennessier (LPM, Montpellier, France), Manuel Ruiz, Quentin Kaas and François Ehrenmann (LIGM, Montpellier, France)),

    The IMGT IMGT/Collier de Perles for V-DOMAIN are according to the IMGT unique numbering for V-DOMAIN [7].
    IMGT amino acid classes (hydropathy, volume, chemical characteristics) are according to Pommié et al [8].




    Note that: If the option "IMGT Collier de Perles (for a nb of sequences < 5)" has been selected in "Display results" of the Search page, the Collier de Perles in PNG format is shown directly in the results page (except for TR alpha sequences because IMGT Collier de perles may be wrongly displayed for some submitted sequences).



Results for scFv

On the top of the result page, a table summarizes the identified scFv.
The table includes one line per scFv with the sequence identifier, the 5'V-DOMAIN ID, the 5'V-DOMAIN positions in the sequence, the 5'V-DOMAIN lengths, positions and length of the "linker" between the 2 V-DOMAIN, the 3'V-DOMAIN ID, the 3'V-DOMAIN positions in the sequence and the 3'V-DOMAIN lengths, respectively.

V Each V-DOMAIN is named with the sequence identifier followed by an "_" (underscore) and a capital letter for the locus (H, K, L for IGH, IGK and IGL, and A, B, D and G for TRA, TRB, TRD and TRG, respectively).

The link associated to the V-DOMAIN ID leads to the corresponding detailed results as described in IMGT/V-QUEST ouput .
On the top of the detailed results for each V-DOMAIN, the associated V-DOMAIN identifier is indicated between parentheses and the results of this domain can be reached by clicking on the link.

B. Synthesis view

Top of the IMGT/V-QUEST result page

The top of the IMGT/V-QUEST result page indicates:
- the IMGT/V-QUEST program version,
- the IMGT/V-QUEST reference directory release

and recalls the parameters selected in the IMGT/V-QUEST Search page:
- Species: for example, Homo sapiens
- Receptor type or locus: IG or TR
- IMGT reference directory set: for example, F+ORF+in-frame P (by default)
- Search for insertions and deletions: yes or no
- The "Nb of nucleotides to add (or exclude) in 3' of the V-REGION for the evaluation of the alignment score" and "Nb of nucleotides to exclude in 5' of the V-REGION for the evaluation of the nb of mutations" are indicated if default values have been modified in the Search page.

- The "Analysis of single chain Fragment variable (scFv)" is indicated if the option is selected

The number of analysed sequences is displayed.

Summary Table

The result summary is provided as a table with one row for each input sequence, including:

Results of IMGT/JunctionAnalysis

Links to the results of IMGT/JunctionAnalysis for the junctions are provided .

Alignment with the closest alleles

The names of the closest V-GENE alleles with which your sequences have been aligned are shown, with the number of sequences aligned to each allele indicated between parentheses.
The name of each allele is directly linked to its corresponding results.

Results for each V-GENE and allele

The results may include (if selected in the input page):

  1. Alignment for V-GENE
  2. V-REGION alignment
  3. V-REGION translation
  4. V-REGION protein display
  5. V-REGION protein display with colored AA according to IMGT AA classes
  6. V-REGION protein display (mutations displayed)
  7. V-REGION most frequently occurring AA per position and per FR-IMGT and CDR-IMGT
  8. Results of IMGT/JunctionAnalysis

Note that sequence names longer than 35 characters are truncated in the alignments and in the Results of IMGT/JunctionAnalysis.

Example : the sequence of AF184762 accession number.



  1. Alignment for V-GENE


    This alignment shows your sequences which express the same V aligned with the closest V-REGION allele from the IMGT/V-QUEST reference directory sets. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering or nucleotides that are not taken into account for the alignments.

    • Hot spot positions are underlined in the V-REGION or the closest allele.
    • The score is indicated for each user sequences.
    • The name of the closest J-GENE allele, if found, is indicated at the end of th alignment

  2. V-REGION alignment.

    The sequences are shown with the IMGT unique numbering and with the IMGT framework region ( FR-IMGT) and complementarity determining region ( CDR-IMGT) delimitations. Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering.


    • Hot spot positions are underlined in the V-REGION or the closest allele.
    • The score is indicated for each user sequences.
    • The name of the closest J-GENE allele, if found, is indicated at the end of th alignment



    The resulting alignment shows the CDR3-IMGT of the germline V-REGION alleles of the IMGT reference directory sets.

  3. V-REGION translation

    The "V-REGION Translation " shows the nucleotide sequence and deduced amino acid translation of the closest V-REGION aligned with the user sequences, and with the FR-IMGT and CDR-IMGT delimitations.

    • Hot spot positions are underlined in the V-REGION or the closest allele.
    • The score is indicated for each user sequences.
    • The name of the closest J-GENE allele, if found, is indicated at the end of th alignment




  4. V-REGION protein display

    The "V-REGION protein display" shows the V-REGION protein display of user sequences aligned with the closest V-REGION allele.




  5. V-REGION protein display (with AA class colors)

    The "V-REGION protein display" shows the V-REGION protein display of user sequences aligned with the closest V-REGION allele with colored AA according to the AA IMGT classes.




  6. V-REGION protein display (only AA changes displayed)

    The "V-REGION protein display" shows the V-REGION protein display of user sequences aligned with the closest V-REGION allele with only the mutations displayed.




  7. V-REGION most frequently occurring AA per position and per FR-IMGT and CDR-IMGT

    The "V-REGION most frequently occurring AA per position and per FR-IMGT and CDR-IMGT" shows a table, for each FR-IMGT and CDR-IMGT, indicating for each amino acid position the most frequently occurring AA.



  8. Results of IMGT/JunctionAnalysis

    The "Results of IMGT/JunctionAnalysis" shows the results of IMGT/JunctionAnalysis of JUNCTION user sequences per chain type, including Analysis of the JUNCTIONs and Translation of the JUNCTIONs

    Note that the "Results of IMGT/JunctionAnalysis" for Synthesis view is available for 'HTML' format only (not for 'Text' format).



Results for scFv

In the summary table, an scFv is identified by its number in the submitted files and by its sequence identifier.
The 2 V-DOMAIN of the scFv appears individually on consecutive lines of the table.

C. Excel file

For the option "Display 1 CSV file in your browser", the top of the IMGT/V-QUEST result page indicates:
- the IMGT/V-QUEST program version,
- the IMGT/V-QUEST reference directory release
and recalls the parameters selected in the IMGT/V-QUEST Search page:
- Species: for example, Homo sapiens
- Receptor type or locus: IG or TR
- IMGT reference directory set: for example, F+ORF+in-frame P (by default)
- Search for insertions and deletions: yes or no
- "Nb of nucleotides to add (or exclude) in 3' of the V-REGION for the evaluation of the alignment score" and
- "Nb of nucleotides to exclude in 5' of the V-REGION for the evaluation of the nb of mutations" are indicated if default values have been modified in the Search page.
- Analysis of single chain Fragment variable (scFv): yes or no
- Number of submitted sequences

The Excel file comprises 11 main sheets (equivalent for IMGT/HighV-QUEST to the 11 CSV files).

Note that a 12th file is added for Advanced functionalities, Analysis of single chain Fragment variable (scFv)

Table : Results content of the eleven (or twelve) IMGT/V-QUEST results spreadsheets or CSV files (and of IMGT/highV-QUEST CSV files) [ 13 ]. Citing this table [ 13 ].

Detailed columns are available by cliking on the "File name".


File number File name Number of columns filled Results content *
#1 "Summary" 33 (or 29) - Alignment score and identity percentage with the closest V and J genes and alleles,
- D-REGION reading frame,
- FR-IMGT and CDR-IMGT lengths,
- Amino acid (AA) JUNCTION,
- Description of insertions and deletions if any,
- User sequence in the direct orientation,
- Sequence orientation at the submission, the number of trimmed "n" before analysis if any, sequence length, sequence category.
#2 "IMGT-gapped-nt-sequences" 18 - Nucleotide (nt) sequences gapped according to the IMGT unique numbering for the labels V-D-J-REGION, V-J-REGION, V-REGION, FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT,
- nt sequences of CDR3-IMGT, JUNCTION, J-REGION and FR4-IMGT.
#3 "nt-sequences " 118 - nt sequences of all labels that can be automatically described and delimitated by IMGT/Automat (57 columns for IGL, IGK, TRA and TRG sequences, 79 (if one D), 91 (if two D) or 103 (if 3 D) columns for IGH, TRB and TRD sequences). The 3 last columns evaluate the number of missing nt for partial V-(D)-J-REGION and of uncertain nt in V-REGION
#4 "IMGT-gapped-AA-sequences" 18 - AA sequences gapped according to the IMGT unique numbering for the labels V-D-J-REGION, V-J-REGION, V-REGION, FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT,
- AA sequences of CDR3-IMGT, JUNCTION, J-REGION and FR4-IMGT.
#5 "AA-sequences" 18 Same columns as "IMGT-gapped-AA-sequences" (#4), but sequences of labels are without IMGT gaps.
#6 "Junction" 85 - Results of IMGT/JunctionAnalysis (36 columns for IGL, IGK, TRA and TRG sequences, 50 (if one D), 62 (if two D) or 77 (if 3 D) columns for IGH, TRB and TRD sequences).
#7 "V-REGION-mutation-and-AA-change-table" 11 - List of mutations (nt mutations, AA changes, codon change, hotspot motifs, AA class identity (+) or change (-)) for V-REGION, FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT and germline CDR3-IMGT.
#8 "V-REGION-nt-mutation-statistics " 130 - Number (nb) of nt positions including IMGT gaps, nb of nt, nb of identical nt, total nb of mutations, nb of silent mutations, nb of nonsilent mutations, nb of transitions (a>g, g>a, c>t, t>c) and nb of transversions (a>c, c>a, a>t, t>a, g>c, c>g, g>t, t>g) for V-REGION, FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT and germline CDR3-IMGT.
#9 "V-REGION-AA-change-statistics " 109 - nb of AA positions including IMGT gaps, nb of AA, nb of identical AA, total nb of AA changes, nb of AA changes according to AAclassChangeType (+++, ++-, +-+, +--, -+-, --+, ---), and nb of AA class changes according to AAclassSimilarityDegree (nb of Very similar, nb of Similar, nb of Dissimilar, nb of Very dissimilar) for V-REGION, FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT and germline CDR3-IMGT.
#10 " V-REGION-mutation-hotspots " 8 - Hot spots motifs ((a/t)a, t(a/t), (a/g)g(c/t)(a/t), (a/t)(a/g)c(c/t)) detected in the closest germline V-REGION with positions in FR-IMGT and CDR-IMGT.
#11 "Parameters " - Date of the analysis,
- IMGT/V-QUEST programme version, IMGT/V-QUEST reference directory release,
- Parameters used for the analysis: species, receptor type or locus, IMGT reference directory set and Advanced parameters.
#12 "scFv " 40 Available only for Advanced functionalities, Analysis of single chain Fragment variable (scFv).
- positions and length, CDR_length, JUNCTION for the 2 V-DOMAIN of the scFv
- positions and length of the linker
*: Files #1 to #10 and #12 comprise systematically sequence identification, i.e. the sequence name, the functionality, the names of the closest V gene and allele, and files #1 to #6 and #12 also include the D and J genes and alleles. The files #7 to #10 that report the analysis of mutations are used mostly for immunoglobulins (IG). Files #1 to #10 include one line per submitted sequence or V-DOMAIN. File #12 includes one line per scFv

Detailed columns per spreadsheet or CSV file :

  1. "Summary" spreadsheet includes:
    • Sequence number
    • Sequence ID
    • V-DOMAIN Functionality: provides the functionality. A message "(see comment)" may be added. It indicates that a comment related to the functionality has been added in the column "V-DOMAIN Functionality comment"
    • V-GENE and allele: provides the closest V-GENE and allele name(s). A message "(see comment)" may be added. It indicates that a comment related to potential insertions and/or deletions has been added in the column "V-REGION potential ins/del".
    • V-REGION score
    • V-REGION identity %
    • V-REGION identity nt
    • V-REGION identity % (with ins/del events): this field is shown if the option "Search for insertions and deletions" is selected. It indicates the percentage of identity and ratio considering each insertion or deletion as one mutational event. For each insertion or deletion, whatever its length, "1" is subtracted from the number of identical nucleotides
    • V-REGION identity nt (with ins/del events): this field is shown if the option "Search for insertions and deletions" is selected. It indicates the percentage of identity and ratio considering each insertion or deletion as one mutational event. For each insertion or deletion, whatever its length, "1" is subtracted from the number of identical nucleotides
    • J-GENE and allele: provides the closest J-GENE and allele name(s). A message "(see comment)" may be added. It indicates that a comment related to other possibilities for the J identification has been added in the column "J-GENE and allele comment".
    • J-REGION score
    • J-REGION identity %
    • J-REGION identity nt
    • D-GENE and allele: provides the closest D-GENE and allele name(s) identified by IMGT/JunctionAnalysis
    • D-REGION reading frame
    • CDR1-IMGT length
    • CDR2-IMGT length
    • CDR3-IMGT length
    • CDR-IMGT lengths
    • FR-IMGT lengths
    • AA JUNCTION (with restored frameshift for out-of-frame junctions, indicated with # in the sequence)

      Note that :
      • If the JUNCTION is delimitated but can't be analysed by IMGT/JunctionAnalysis, the AA JUNCTION is followed by the message "(see V-DOMAIN Functionality comment)" and the message "IMGT/JunctionAnalysis gives no results for this JUNCTION" is added in "V-DOMAIN Functionality comment".

    • JUNCTION frame
    • Orientation: a sign + indicates "sense" orientation for the cDNA. A sign - indicates "antisens orientation" and therefore, that the sequence was complementary reversed for the IMGT/V-QUEST analysis.
    • V-DOMAIN Functionality comment: explains why the functionality is identified as "unproductive" or "unknown", or adds comments related to the analysis of the JUNCTION.
    • V-REGION potential ins/del: this field is filled if insertions or deletions may be suspected.
    • J-GENE and allele comment: this field is filled if other possibilities exist for the choice of the J-GENE and allele
    • V-REGION insertions: this field is shown if the option "Search for insertions and deletions" is selected. It indicates the localization of the insertion(s)
    • V-REGION deletions: this field is shown if the option "Search for insertions and deletions" is selected. It indicates the localization of the deletion(s)
    • Sequence: the user sequence

      Note that :
      • The sequence is always displayed in the "sense" orientation whatever the orientation at the submission. The results provided in the other spreadsheets of the Excel file correspond to the IMGT/V-QUEST analysis of the sequence in the sense orientation.
      • If the option "Search for insertions and deletions" is selected and if insertions have been detected, they appear in capital letters in the user sequence. The results provided in the other spreadsheets of the Excel file correspond to the IMGT/V-QUEST analysis after removal of the insertions.

    • "5prime trimmed-n nb" and "3prime trimmed-n nb" (see IMGT/V-QUEST annexes).
    • Analysed sequence length
    • Sequence analysis category (see IMGT/V-QUEST annexes).

  2. "IMGT-gapped-nt-sequences" spreadsheet includes:
    • Sequence number
    • Sequence ID
    • V-DOMAIN Functionality
    • V-GENE and allele
    • J-GENE and allele
    • D-GENE and allele
    • Then nt-sequences of:
      • V-D-J-REGION : gapped according to the IMGT numbering, if described
      • V-J-REGION : gapped according to the IMGT numbering, if described
      • V-REGION : gapped according to the IMGT numbering
      • FR1-IMGT: gapped according to the IMGT numbering
      • CDR1-IMGT: gapped according to the IMGT numbering
      • FR2-IMGT: gapped according to the IMGT numbering
      • CDR2-IMGT: gapped according to the IMGT numbering
      • FR3-IMGT: gapped according to the IMGT numbering
      • CDR3-IMGT
      • JUNCTION
      • J-REGION
      • FR4-IMGT

  3. "nt-sequences" spreadsheet includes:
    • Sequence number
    • Sequence ID
    • V-DOMAIN Functionality
    • V-GENE and allele
    • J-GENE and allele
    • D-GENE and allele
    • Then nt-sequences of all constitutive labels of the V-J or V-D-J-REGION
      • V-D-J-REGION: if described
      • V-J-REGION if described
      • V-REGION
      • FR1-IMGT
      • CDR1-IMGT
      • FR2-IMGT
      • CDR2-IMGT
      • FR3-IMGT
      • CDR3-IMGT
      • JUNCTION
      • labels of the JUNCTION (see 6, Junction spreadsheet section, 'nt sequence of') and (N-D)-REGION
      • D-J-REGION
      • J-REGION
      • FR4-IMGT
    • Start and end positions of all constitutive labels of the V-J or V-D-J-REGION
    • V-DOMAIN (or V-REGION) reading frame in the sequence
    • V-REGION partial 5prime missing nt nb (see IMGT/V-QUEST annexes)
    • V-REGION uncertain nt nb (see IMGT/V-QUEST annexes)
    • J-REGION partial 3prime missing nt nb (see IMGT/V-QUEST annexes)

  4. "IMGT-gapped-AA-sequences" spreadsheet includes:
    • Sequence number
    • Sequence ID
    • V-DOMAIN Functionality
    • V-GENE and allele
    • J-GENE and allele
    • D-GENE and allele
    • Then AA-sequences of:
      • V-D-J-REGION : gapped according to the IMGT numbering, if described
      • V-J-REGION : gapped according to the IMGT numbering, if described
      • V-REGION : gapped according to the IMGT numbering
      • FR1-IMGT: gapped according to the IMGT numbering
      • CDR1-IMGT: gapped according to the IMGT numbering
      • FR2-IMGT: gapped according to the IMGT numbering
      • CDR2-IMGT: gapped according to the IMGT numbering
      • FR3-IMGT: gapped according to the IMGT numbering
      • CDR3-IMGT
      • JUNCTION
      • J-REGION
      • FR4-IMGT

  5. "AA-sequences" spreadsheet includes:
    • Sequence number
    • Sequence ID
    • V-DOMAIN Functionality
    • V-GENE and allele
    • J-GENE and allele
    • D-GENE and allele
    • Then, AA-sequences of:
      • V-D-J-REGION: if described
      • V-J-REGION if described
      • V-REGION
      • FR1-IMGT
      • CDR1-IMGT
      • FR2-IMGT
      • CDR2-IMGT
      • FR3-IMGT
      • CDR3-IMGT
      • JUNCTION
      • J-REGION
      • FR4-IMGT

  6. "Junction" spreadsheet includes:
    • Sequence number
    • Sequence ID
    • V-DOMAIN Functionality
    • V-GENE and allele
    • J-GENE and allele
    • D-GENE and allele
    • JUNCTION frame
    • Then nt-sequences of labels of the JUNCTION:
      • JUNCTION
      • JUNCTION with restored frameshift, for out-of-frame junctions
      • 3'V-REGION
      • P3'V: palindromic (P) nucleotides added downstream (in 3') of the V-REGION
      • N-REGION
      • N1-REGION
      • P5'D: palindromic (P) nucleotides added upstream (in 5') of the D-REGION
      • D-REGION
      • P3'D: palindromic (P) nucleotides added downstream (in 3') of the D-REGION
      • N2-REGION
      • P5'J: palindromic (P) nucleotides added upstream (in 5') of the J-REGION
      • 5'J-REGION
    • Number of nucleotides (nt-nb):
      • Sequence number
      • JUNCTION nt nb
      • 3'V-REGION nt nb
      • P3'V nt nb: number of palindromic (P) nucleotides added downstream (in 3') of the V-REGION
      • N-REGION nt nb
      • N1-REGION nt nb
      • P5'D nt nb: number of palindromic (P) nucleotides added upstream (in 5') of the D-REGION
      • D-REGION nt nb
      • P3'D nt nb: number of palindromic (P) nucleotides added downstream (in 3') of the D-REGION
      • N2-REGION nt nb
      • P5'J nt nb: number of palindromic (P) nucleotides added downstream (in 5') of the J-REGION
      • 5'J-REGION nt nb
    • The number of trimmed nt (trimmed-nt nb):
      • 3'V-REGION trimmed-nt nb: number of V nucleotides trimmed off the 3' end of the germline V-REGION
      • D-REGION 5' trimmed-nt nb: number of D nucleotides trimmed off the 5' end of the germline D-REGION
      • D-REGION 3' trimmed-nt nb: number of D nucleotides trimmed off the 3' end of the germline D-REGION
      • 5'J-REGION trimmed-nt nb: number of J nucleotides trimmed off the 5' end of germline J-REGION
    • The number of mutations (mut-nt nb):
      • 3'V-REGION mut-nt nb: number of mutations detected in the 3'V-REGION
      • D-REGION mut-nt nb: number of mutations detected in the D-REGION
      • 5'J-REGION mut-nt nb: number of mutations detected in the J-REGION
    • D-REGION reading frame
    • Ngc: gc ratio in nt-sequences encoding N-REGION(s) (N-REGION or N1-REGION+N2-REGION, etc.)
    • CDR3-IMGT length
    • Molecular mass
    • pI
    • The parameters used by IMGT/JunctionAnalysis:
      • 3'V-REGION accepted-mut nb: number of accepted mutation in the 3'V-REGION, parameter used by IMGT/V-QUEST and IMGT/JunctionAnalysis
      • D-REGION accepted-mut nb: number of accepted mutations in the D-REGION, parameter used by IMGT/V-QUEST and IMGT/JunctionAnalysis
      • 5'J-REGION accepted mut-nb: number of accepted mutation in the 5'J-REGION, parameter used by IMGT/V-QUEST and IMGT/JunctionAnalysis
      • Nb of accepted D-GENE in the JUNCTION for IGH, TRB and TRD loci, parameter used by IMGT/V-QUEST and IMGT/JunctionAnalysis
    • CDR3-IMGT : CDR3-IMGT in nucleotides
    • CDR3-nt nb : CDR3-IMGT length in nucleotides
    • CDR3-IMGT (with frameshift): CDR3-IMGT in nucleotides with restored frameshift (for out-of-frame junctions)
    • CDR3-IMGT (AA): CDR3-IMGT in amino acids
    • CDR3-IMGT (AA) (with frameshift): CDR3-IMGT in amino acids with restored frameshift (for out-of-frame junctions)
    • JUNCTION (AA): JUNCTION in amino acids
    • JUNCTION (AA) (with frameshift): JUNCTION in amino acids with restored frameshift (for out-of-frame junctions)

  7. "V-REGION-mutation-and-AA-change-table" spreadsheet includes:
    • Sequence number
    • Sequence ID
    • V-DOMAIN Functionality
    • V-GENE and allele
    • Then, list of mutations (nt mutation, AA change, codon change, hotspot motif, and AA class identity (+) or change (-)) for :
      • V-REGION
      • FR1-IMGT
      • CDR1-IMGT
      • FR2-IMGT
      • CDR2-IMGT
      • FR3-IMGT
      • CDR3-IMGT

    In a given field, mutations are separated with "|".
    The details for the description of a mutation are available in Correlation between V-REGION mutations, AA changes, codons changes and hotspots motifs)

  8. "V-REGION-nt-mutation-statistics" spreadsheet includes:
    • Sequence number
    • Sequence ID
    • V-DOMAIN Functionality
    • V-GENE and allele
    • Then, for V-REGION, FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT, germline CDR3-IMGT:
      • Nb of positions including IMGT gaps
      • Nb of nucleotides
      • Nb of identical nucleotides
      • Total nb of mutations
      • Nb of silent mutations
      • Nb of nonsilent mutations
      • The number of transitions
        • a>g
        • g>a
        • c>t
        • t>c
      • The number of transversions
        • a>c
        • c>a
        • a>t
        • t>a
        • g>c
        • c>g
        • g>t
        • t>g

  9. "V-REGION-AA-change-statistics" spreadsheet includes:
    • Sequence number
    • Sequence ID
    • V-DOMAIN Functionality
    • V-GENE and allele
    • Then, for V-REGION, FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT, FR3-IMGT, germline CDR3-IMGT:
      • Nb of positions including IMGT gaps (AA)
      • Nb of AA
      • Nb of identical AA
      • Total nb of AA changes
      • Nb of AA changes according to AAclassChangeType
        • +++
        • ++-
        • +-+
        • +--
        • -+-
        • --+
        • ---
      • Nb of AA class changes according to AAclassSimilarityDegree
        • Nb of Very similar
        • Nb of Similar
        • Nb of Dissimilar
        • Nb of Very dissimilar

  10. "V-REGION-mutation-hotspots" spreadsheet includes:
    • Sequence number
    • Sequence Id
    • V-DOMAIN Functionality
    • V-GENE and allele
    • Then, Hot spots motifs detected in the closest germline V-REGION with positions and CDR-IMGT and FR-IMGT localization
      • (a/t)a
      • t(a/t)
      • (a/g)g(c/t)(a/t)
      • (a/t)(a/g)c(c/t)

  11. "Parameters" spreadsheet includes the date of the analysis, and the general and advanced parameters used by IMGT/V-QUEST:
    • Date of the analysis
    • IMGT/V-QUEST program version
    • IMGT/V-QUEST reference directory release
    • Species selected for the IMGT reference directory
    • Receptor type or locus
    • Then, selected Advanced parameters:
      • IMGT reference directory set
      • With allele *01 only : indicated only if that option was selected
      • Search for insertions and deletions: yes or no
      • Nb of nucleotides to add (or exclude) in 3' of the V-REGION for the evaluation of the alignment score
      • Nb of nucleotides to exclude in 5' of the V-REGION for the evaluation of the nb of mutations
      • Analysis of scFV: yes or no
      • Number of submitted sequences

  12. "scFv" sheet is available only for Advanced functionalities, Analysis of single chain Fragment variable (scFv).
    It includes 1 line per submitted sequence identified as an scFv (at least 2 V-REGION in the same sequence).
    One line comprises 2 groups of columns: one prefixed by "1_" for one V-DOMAIN and the second group prefixed by "2_" for the other V-DOMAIN of the scFv. They are separated by 2 columns for positions and length of the scFv linker sequence.

    In order to facilitate data extraction or reuse, fields corresponding to the IGH for IG, or to the TRB or TRD for TR V-DOMAIN are arbitrary in the "1_" column group, whatever their order (5' V-DOMAIN or 3' V-DOMAIN) in the submitted scFv sequence.

    Note that : Sequences not identified as scFv (with a single V-DOMAIN or a single V-REGION) are not integrated in this file, so the 12_ scFv spreadsheet or file can be empty if none of the submitted sequences are scFv.

    • 1_Sequence number: sequence (or domain) number as it is numbered in the 10 first spreadsheets or files
    • 1_Sequence ID : (or domain) identifier_capital letter for the locus
    • 1_V-DOMAIN positions : begin and end position of the V-DOMAIN in sequence, which corresponds to V-D-J-REGION for IGH, TRB and TRD locus or to V-J-REGION for IGK, IGL, TRA or TRG locus.
    • 1_V-DOMAIN length : length of the V-DOMAIN in nt.
    • 1_V-DOMAIN Functionality: functionality of the V-DOMAIN
    • 1_V-GENE and allele: IMGT gene and allele name of the closest V germline
    • 1_V-REGION score: alignment score with of the closest V germline
    • 1_V-REGION identity %: identity percentage with the closest V germline
    • 1_V-REGION identity nt: number of identical nt with the closest V germline
    • 1_J-GENE and allele: IMGT gene and allele name of the closest J germline
    • 1_J-REGION score: alignment score with of the closest J germline
    • 1_J-REGION identity %: identity percentage with the closest J germline
    • 1_J-REGION identity nt: number of identical nt with the closest V germline
    • 1_D-GENE and allele: IMGT gene and allele name of the closest D germline
    • 1_D-REGION reading frame: reading frame of the D-REGION
    • 1_CDR_lengths: length of the 3 CDR-IMGT lengths
    • 1_JUNCTION frame: in-frame or out-of-frame
    • 1_AA JUNCTION: amino acid sequence of the junction
    • 1_Comments: in order to alert the user on sequence particularites that should be checked in the Summary spreadsheet or file
    • Linker positions: positions of sequence which links both domains
    • Linker length: length in nt of the sequence which links both domains
    • 2_Sequence number: sequence (or domain) number as it is numbered in the 10 first spreadsheets or files
    • 2_Sequence ID : (or domain) identifier_capital letter for the locus
    • 2_V-DOMAIN positions : begin and end position of the V-DOMAIN in sequence, which corresponds to V-D-J-REGION for IGH, TRB and TRD locus or to V-J-REGION for IGK, IGL, TRA or TRG locus.
    • 2_V-DOMAIN length : length of the V-DOMAIN in nt.
    • 2_V-DOMAIN Functionality: functionality of the V-DOMAIN
    • 2_V-GENE and allele: IMGT gene and allele name of the closest V germline
    • 2_V-REGION score: alignment score with of the closest V germline
    • 2_V-REGION identity %: identity percentage with the closest V germline
    • 2_V-REGION identity nt: number of identical nt with the closest V germline
    • 2_J-GENE and allele: IMGT gene and allele name of the closest J germline
    • 2_J-REGION score: alignment score with of the closest J germline
    • 2_J-REGION identity %: identity percentage with the closest J germline
    • 2_J-REGION identity nt: number of identical nt with the closest V germline
    • 2_D-GENE and allele: IMGT gene and allele name of the closest D germline
    • 2_D-REGION reading frame: reading frame of the D-REGION
    • 2_CDR_lengths: length of the 3 CDR-IMGT lengths
    • 2_AA JUNCTION: amino acid sequence of the junction
    • 2_JUNCTION frame: in-frame or out-of-frame
    • 2_Comments: in order to alert the user on sequence particularites that should be checked in the Summary spreadsheet or file

D. Results provided following "Search for insertions and deletions" (Advanced parameters)

The option "Search for insertions and/or deletions" of Advanced parameters has to be selected at the bottom of the IMGT/V-QUEST Search page.

Note that:

Results provided in case of insertions

  1. in "Detailed view"

    • The detected nucleotide insertions in the submitted sequence by comparison to the IMGT unique numbering are displayed as capital letters in the FASTA sequence (at the top of results).

    • The insertions are described in the Result summary table with:
      - their localization in V-REGION
      - the display of inserted nucleotides
      - the indication if the insertions cause a frameshift
      - the V-REGION codon number (according to the IMGT numbering) from which begin the insertions
      - the nucleotide position in user submitted sequence from which begin the insertions

    • Then IMGT/V-QUEST provides the results of the analysis after removal of the insertions (functionality evaluation, gene and allele identification, ...).

    • In "identity" cell are shown between brackets the percentage of identity and ratio considering each insertion or deletion as one mutational event.
      If (an) insertion(s) is (are) detected, the percentage of identity is calculated after removal of the insertions. Each insertion is then counted as one mutational event whatever its length. The resulting percentage of identity and ratio are shown between brackets.

  2. in "Synthesis view"

    • IMGT/V-QUEST provides the results of the analysis after removal of the insertions
    • A note indicates the sequences for which insertions have been detected. It is strongly recommended to check the description of the insertions in "Detailed view".

  3. in "Excel file"

    Four additional columns are added in the Summary sheet:

    - V-REGION identity % (with ins/del events): it indicates the percentage of identity and ratio considering each insertion or deletion as one mutational event. For each insertion or deletion, whatever its length, "1" is subtracted from the number of identical nucleotides.
    - V-REGION identity nt (with ins/del events): it indicates the percentage of identity and ratio considering each insertion or deletion as one mutational event. For each insertion or deletion, whatever its length, "1" is subtracted from the number of identical nucleotides.
    - V-REGION insertions: it indicates the sequence, the length and the localization of the insertion(s).
    - V-REGION deletions: it indicates the localization and the length of the deletion(s).

    Note that : insertions appear in capital letters in the user sequence. The results provided in the other sheets of the Excel file correspond to the IMGT/V-QUEST analysis after removal of the insertions.

Results provided in case of deletions

  1. in "Detailed view"

    • The deletions are described in the Result summary table with:
      - their localization in V-REGION
      - the number tof deleted nucleotides - the indication if the deletions cause a frameshift
      - the V-REGION codon number (according to the IMGT numbering) from which begin the deletions
      - the nucleotide position in user submitted sequence from which begin the deletions

    • Then IMGT/V-QUEST provides the results of the analysis after filling the deletion(s) gap(s) to restore the IMGT numbering (functionality evaluation, gene and allele idntification, ...)

    • In "identity" cell are shown between brackets the percentage of identity and ratio considering each insertion or deletion as one mutational event.
      If (a) deletion(s) is (are) detected, the percentage of identity is calculated after after filling the deletion(s) gap(s). Each deltion is then counted as one mutational event whatever its length. The resulting percentage of identity and ratio are shown between brackets.

  2. in "Synthesis view"

    • IMGT/V-QUEST provides the results of the analysis after filling the deletion(s) gap(s) to restore the IMGT numbering
    • A note indicates the sequences for which deletions have been detected. It is strongly recommended to check the description of the deletions in "Detailed view".

  3. in "Excel file"

    Three additional columns are added in the Summary sheet:

    - V-REGION identity % (with ins/del events): it indicates the percentage of identity and ratio considering each insertion or deletion as one mutational event. For each insertion or deletion, whatever its length, "1" is subtracted from the number of identical nucleotides.
    - V-REGION identity nt (with ins/del events): it indicates the percentage of identity and ratio considering each insertion or deletion as one mutational event. For each insertion or deletion, whatever its length, "1" is subtracted from the number of identical nucleotides.
    - V-REGION deletions: it indicates the localization of the deletion(s).

IMGT/V-QUEST annexes

IMGT/V-QUEST evaluation of sequence functionality and messages

List of warnings and messages displayed in IMGT/V-QUEST results

Trimming of nucleotides "n" at 5' and/or 3' end of the submitted sequences

The nucleotides "n" at 5' and/or 3' end of the submitted sequences are automatically trimmed before the analysis. The numbers of 5' trimmed-n and 3' trimmed-n are indicated:
- In Detailed view: before the "Analysed sequence length" (Nb of 5' trimmed-n, Nb of 3' trimmed-n), only if greater than 0.
- In Synthesis view: in columns "5prime trimmed-n nb" and "3prime trimmed-n nb" of the Summary table.
- In Excel File: in columns "5prime trimmed-n nb" and "3prime trimmed-n nb" of the spreadsheet "Summary".

Human IGH sequence for test: 

>test
nnnnaaccaccgcagaaattgtgttgacgcagtctccgggcaccctgtctttgtctccag
gggaaggagccaccctctcctgcagggccagtcagtattttggctccaactacttagcct
ggtaccaacagaaacctggccaggctccccggctcctcgtctatggtgcatccagcaggg
ccactggcatcccagacaggtttattggcagtgtgtctgtgacagacttcactctcacca
tcacccgactggagcctgaagattttgcaatatattactgtcatcggtatggaacctcac
ctccgatcacttcggccaagggacacgactggagattaaacnnnnnnnn

Evaluation of the number of missing nt in 5'V-REGION and 3'J-REGION for partial V-(D)-J-REGION

In case of partial V-(D)-J-REGION, the numbers of missing nt in 5' of the V-REGION and/or in 3' of the J-REGION are indicated:
- In Detailed view: below the 'Results summary' table (V-REGION partial 5' missing nt nb, J-REGION partial 3' missing nt nb), only if greater than 0.
- In Synthesis view: in columns "V-REGION partial 5prime missing nt nb" and "J-REGION partial 3prime missing nt nb" of the Summary table.
- In Excel File: in columns "V-REGION partial 5prime missing nt nb" and "J-REGION partial 3prime missing nt nb" of the spreadsheet "Nt-sequences".

Note that: as the last nt of the germline J is not part of the J-REGION in cDNA (but contributes to the fist codon of the C-REGION, see L-V-J-C-SEQUENCE AND L-V-D-J-C-SEQUENCE prototypes), this nt is not taken into account in the evaluation of the J-REGION partial 3' missing nt nb.

Human IGH sequence for test: 

>test 
tctggggctgaggtgaaggagcctggggcctcagcgaaggtctcctgcatgacttctgga
tacacgttcacaagatacgctctgcattgggtgcgacaggcccctggacaaggacttgag
tgggtgggatggatcatccccaacagtggtgacacaaggtatgaacagaagtttcagggc
agggtcaccctgaccagggacacgtcctcgagcacagcctacatggaactgagcaggctg
acatctgacgacacggccgtatattattgtacgacccataggagtgcctggtactttgct
ttcgacccctggggccagggaaccctggtcacc

Evaluation of uncertain nucleotides in the V-REGION

The number of uncertain nucleotides (other than a, t, g, c) is evaluated in the V-REGION (see Uncertain nucleotides ). This number is indicated:
- In Detailed view: below the 'Results summary' table (V-REGION uncertain nt nb ), only if greater than 0.
- In Synthesis view: in column "V-REGION uncertain nt nb" of the Summary table.
- In Excel File: in column "V-REGION uncertain nt nb" of the spreadsheet "Nt-sequences".

Human IGH sequence for test: 

>Z68927
cagcttctcttcctcctgctactctggctcccagntaccaccggagaaattgtgttgacg
cagtctccaggcaccctgtctttgtctccaggngaaagagccaccctctcctgcagggcc
agtcagagtgttagcagcagctacttagcctggtaccagcagaaacctggnnaggttttc
aggctcctcatctatggtgcatccagcagggccactggcatcccagacaggttcagtggc
agtgggtctgggacagacttcactctcaccatcagcagactggagcctgaagattttgca
gtgtattactgtcatcagtatggtagctcacctcacttttggccaggggaccaagctgga
gatcaaacga

Sequence analysis categories

Four categories for sequence analysis are defined. The description and presentation in the 3 "Display results" are in the following table:

Sequence analysis category Detailed View
(below the analysed sequence length) 		Synthesis View
(column "Sequence analysis category" of the Summary table) 		Excel file
(column "Sequence analysis category" of the Summary spreadsheet)
1 - Analysis without "Search for insertions and deletions in V-REGION" 1 (no indel search) 1 (noindelsearch) 1 (noindelsearch)
2 - Analysis with "Search for insertions and deletions in V-REGION" and corrections if any 2 (indel search & correction) 2 (indelcorr) 2 (indelcorr)
3 - Analysis on complementary reverse sequence without "Search for insertions and deletions in V-REGION" 3 (complementay reverse_no indel search) 3 (complrev_noindelsearch) 3 (complrev_noindelsearch)
4 - Analysis on complementary reverse sequence with "Search for insertions and deletions in V-REGION" and corrections if any 4 (complementary reverse_indel search & correction) 4 (complrev_indelcorr) 4 (complrev_indelcorr)

References:

[1] Giudicelli, V. et al. Nucl. Acids Res. 32, W435-440 (2004) PMID:15215425 LIGM:287
[2] Belessi C.J. et al. Eur J Immunol. 36, 1963-74 (2006). PMID:16783849
[3] Giudicelli, V. et al. Stud. Health Technol. Inform. 116, 3-8 (2005) PMID:16160227 LIGM:298
[4] Yousfi Monod, M. et al. Bioinformatics , 20, i379-i385 (2004) PMID:15262823 LIGM:289
[5] Lefranc, M.-P. Methods Mol. Biol. 248, 27-49 (2004) PMID:14970490 LIGM:277
[6] Lefranc, M.-P. Current Protocols in Immunology pp. A1W.1-A.1W.15 (2006) PMID:18432961 LIGM:311
[7] Lefranc, M.-P. et al., Dev. Comp. Immunol., 27, 55-77 (2003) PMID:12477501 LIGM:268
[8] Pommié, C. et al. J. Mol. Recognit., 17, 17-32 (2004) PMID:14872534 LIGM:284
[9] Giudicelli, V et al. In: Proceedings of the European Conference on Computational Biology (ECCB 2003), INRIA (DISC/Spid), Paris, DKB-31, pp.103-104. LIGM communication #357.
[10] Brochet, X. et al. Nucl. Acids Res. 36, W503-508 (2008). PMID:18503082 LIGM:344
[11] Giudicelli, V et al. Cold Spring Harb Protoc. 2011 Jun 1;2011(6): 695-715. pii: pdb.prot5633. doi: 10.1101/pdb.prot5633. PMID:21632778 IMGT booklet high resolutionpdficon lower resolutionpdficon 'With generous provision from Cold Spring Harbor (CSH) Protocols'. LIGM:398.
[12] Alamyar, E et al. In: B. Tait and F. Christiansen (Eds.), Immunogenetics, chap 32, Humana Press, Springer, New York, USA. Methods Mol. Biol. 882:569-604 (2012) PMID:22665256 LIGM:404.
[13] Giudicelli V., et al., Autoimmun Infec Dis. 1(1) (2015). doi: 10.16966/aidoa.103. Free Article LIGM:448
[14] Giudicelli V., et al., BMC Immunol. Jun 26;18(1):35 (2017). doi: 10.1186/s12865-017-0218-8. PMID: 28651553 Free PMC Article LIGM: 468
[15] Agathangelidis A. et al. Blood. 119, 4467-4475 (2012). doi: 10.1182/blood-2011-11-393694. Epub 2012 Mar 13.
[16] Baliakas P. et al. Lancet Haematol. 1(2):e74-84 (2014). doi: 10.1016/S2352-3026(14)00005-2. Epub 2014 Nov 3.
[17] Baliakas P. et al. Blood. 125, 856-859 (2015). doi: 10.1182/blood-2014-09-600874. Epub 2014 Dec 17.
[18] Stamatopoulos K. et al. Leukemia. 31, 282-291 (2017). doi: 10.1038/leu.2016.322. Epub 2016 Nov 4.
[19] Jaramillo S. et al. Haematologica. haematol.2019.231027 (2019). doi: 10.3324/haematol.2019.231027.