Citing IMGT/JunctionAnalysis:
Yousfi Monod, M. et al., Bioinformatics, 20, i379-i385 (2004). PMID: 15262823.
Giudicelli, V., Lefranc, M.-P., Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.prot5634. doi: 10.1101/pdb.prot5634.
PMID: 21632777 Abstract also in IMGT booklet with generous provision from Cold Spring Harbor (CSH) Protocols (high res) (lower res)

IMGT/JunctionAnalysis program version: 2.3.1 (2 December 2024) - IMGT/JunctionAnalysis reference directory release: 202616-1 (20 April 2026)

Table of contents

Introduction

IMGT/JunctionAnalysis [1], at Montpellier, is an integrated analysis tool for the analysis of Immunoglobulin (IG) and T cell receptor (TR) JUNCTION nucleotide sequences. IMGT/JunctionAnalysis analyses in a single search up to 5000 junctions provided that the IMGT V-GENE and J-GENE and ALLELE names are identified [1-4]. The tool:

IMGT/JunctionAnalysis Welcome page

The IMGT/JunctionAnalysis Welcome page allows to enter the input information.

  1. Selection:
    • Species (drop-down list).
    • Locus (radio buttons): IGH, IGK, IGL, TRA, TRB, TRG, TRD
  2. The analysis of IG and TR junctions of mice and humans can be performed exhaustively. Analysis of junctions of other species (rat, rabbit, trout) becomes progressively more available as genomic sequences are annotated in IMGT.

  3. JUNCTION nucleotide sequences:
    • JUNCTION nucleotide sequences can be entered either directly in the reserved box by typing or by "copy/paste", or by giving the path access to a local file (click on 'Browse' or 'Parcourir' or type its full path in the reserved box).
    • The required format is the FASTA format. Each JUNCTION nucleotide sequences must be preceded by the following information:
      • identifier ("input"), with a 10 character maximum length. This identifier can be a sequence name, an accession number, a clone name, etc.
        Note that the identifier must be unique in a given set of JUNCTION.
      • the name of the V-GENE and ALLELE according to the IMGT gene name nomenclature.
      • the name of the J-GENE and ALLELE according to the IMGT gene name nomenclature.
    • IMGT/JunctionAnalysis accepts up to 5000 junction in a single search. Sequences only need to be entered in the same format, starting a new line for each sequence:
      >Input1, V-GENE and ALLELE name, J-GENE and ALLELE name
      nucleotide sequence (in uppercase or lowercase)
      >Input2, V-GENE and ALLELE name, J-GENE and ALLELE name
      nucleotide sequence (in uppercase or lowercase)
      

      For instance,

      >M62724, IGHV7-4-1*02, IGHJ4*02
      tgtgcgagagaagatagcaatggctacaaaatatttgactactgg
      >Z47269, IGHV1-69*06, IGHJ5*02
      tgtgcgagagggggggctaaggtcgaatttttggagtggtttcatgggtactggttcgacccctgg
      
    • If the V-GENE ALLELE or J-GENE ALLELE is unknown, the JunctionAnalysis tool accepts a '?' character instead of the allele number (ex: IGHV1-2*?) and will run the search against the allele *01 by default.
    • If there are several proposed V-GENE and/or J-GENE, the different V-GENE and ALLELE names and/or J-GENE and ALLELE names have to be separated by the '/' character (ex: IGHV1-2*01/IGHV1-3*?/IGHV1-18*02, IGHJ1*01/IGHJ2*01). The IMGT/JunctionAnalysis tool will run the search against the first V-GENE and ALLELE and J-GENE and ALLELE listed.

    Note that:

    • JUNCTION nucleotide sequences must start with the V-REGION 2nd-CYS codon and end with J-REGION J-PHE or J-TRP codon (positions 104 and 118, respectively, in the IMGT unique numbering for V-DOMAIN [5]).
    • "V-GENE and ALLELE" and "J-GENE and ALLELE" are those obtained by querying IMGT/V-QUEST [6]. If several alleles give the same score, select the most probable one.

  4. Example of IMGT/JunctionAnalysis results

    The selection of the option 'Example of IMGT/JunctionAnalysis results' allows you to vizualize an example of the results provided by IMGT/JunctionAnalysis.

    Sequences used in the 'Example of IMGT/JunctionAnalysis results':

    >Z70256,IGHV2-26*01,IGHJ4*02
    tgtgtacgtgttgtgcagcgcctggtacccaaatatcactttgaccactgg
    >Z70257,IGHV3-7*02,IGHJ2*01
    tgtgcgagggatggcagctcttatgcccgcccctactggtacttcgatctctgg
    >Z70606,IGHV4-31*03,IGHJ3*01
    tgtgcgagagcgactacgcactatgcttttgatgtctgg
    >Z70608,IGHV4-39*02,IGHJ3*02
    tgtgccagagtaacgatttttggagtggttattccccgggggaatgcttttgatatctgg
    >Z70610,IGHV4-34*09,IGHJ3*02
    tgtgcgagagtcgggagcgatttttggagtggttattcccgacatgatgcttttgatatctgg
    >Z70611,IGHV4-59*01,IGHJ5*02
    tgtgcgagacatggtaactataatgccggcgttgactggttcgacccctgg
    >Z70613,IGHV4-59*01,IGHJ4*02
    tgtgcgagagcagcagctggtacctccctctttgactactgg
    >Z70614,IGHV4-59*01,IGHJ4*02
    tgtgcgagacactataattcggggacttatcccctcgactactgg
    >Z70615,IGHV4-59*01,IGHJ2*01
    tgtgcgagagggctggtaaagagggtttcggaatactggtacttcgatctctgg
    >Z70616,IGHV4-34*01,IGHJ5*02
    tgtgcgagagcgggtttgggttcccactggttcgacccctgg
    >Z70620,IGHV4-30-4*01,IGHJ3*02
    tgtgcgagagaccggggcgggatggttcgggatgcttttgatatctgg
    >Z70621,IGHV4-39*01,IGHJ4*02
    tgtgcgagacaccacgatttatggttcggggagtttgacccccttgactactgg
    >Z70622,IGHV4-39*06,IGHJ4*03
    tgtgcgagagattgccccgctcctgccaaaatgtattactatggttcggggatatgtacgtttgactactgg
    
  5. Display Results
    • "List of all eligible D-GENE."
      This option allows one to visualize all D genes that match a junction and to compare their score. It is displayed by default when only one junction is analyzed in the run, but can be disable.

    • "Colored IMGT AA classes and histogram."
      The IMGT AA classes and histogram are displayed by default with colors of the AA according to the 11 IMGT physicochemical AA classes (Pommié et al. 2004) (IMGT Aide-mémoire>Amino acids, https://www.imgt.org) , but can be disable.

    • "Output order" in "CDR3-IMGT length decreasing order" or in "CDR3-IMGT length increasing order."
      The results in "JUNCTION alignments with translation and IMGT AA classes" may be displayed in "Same order as input" (default), in "CDR3-IMGT length decreasing order," or "CDR3-IMGT length increasing order".

  6. Advanced Parameters
    • 5' and 3' ends of the JUNCTION:
      • Default: the JUNCTION nucleotide sequences must start in 5' with a cystein (tgt or tgc) codon and must end in 3' with a tryptophan (tgg) or phenylalanine (ttt or ttc) codon.
      • The JUNCTION nucleotide sequences may start in 5' and/or may end in 3' with any codon.

    • Nb of D-GENE (for IGH, TRB and TRD JUNCTION):
      • Default values are 1 for IGH, 1 for TRB and 3 for TRD.
      • You may modify it from 0 to 3.

    • Number of accepted mutations in 3'V-REGION, D-REGION, and 5'J-REGION:
      • Default values are:

        3'V-REGION and 5'J-REGIOND-REGION
        IGH24
        IGK7NR
        IGL7NR
        TRA0NR
        TRB00
        TRD00
        TRG0NR
        NR= non relevant

        You can modify these numbers from 0 to 10 in the corresponding 3'V-REGION, D-REGION, and 5'J-REGION drop-down lists.

    • Delimitation of 3'V-REGION, D-REGION and 5'J-REGION:

      • Default: ('m' indicates a mutation and '-' indicates an identical nucleotide)

        3'V-REGION delimitation:

        • IGH locus: the patterns 'm', 'm-' and 'mm--' are trimmed from the 3'V-REGION and 3' end of the D-REGION
        • IGL and IGK locus: the patterns 'm', and '-m' are trimmed from the 5'J-REGION and 5' end of the D-REGION
        • TR loci: the patterns 'm', 'm-', 'm--' and 'm---' and 'm----' are trimmed from the 3'V-REGION

        D-REGION delimitation:
        • The patterns 'm', '-m' and '--mm' are trimmed from the 5'end of the D-REGION
        • The patterns 'm', 'm-' and 'mm--' are trimmed from the 3' end of the D-REGION

        5'J-REGION delimitation:
        • IGH locus: the patterns 'm', '-m' and '--mm' are trimmed from the 5'J-REGION
        • IGL and IGK locus: the patterns 'm', and '-m' are trimmed from the 5'J-REGION and 5' end of the D-REGION
        • TR loci: the patterns 'm', '-m', '--m' and '---m' and '----m' are trimmed from the 3'V-REGION

        by comparison with the corresponding alleles germline sequences.

      • Stop trimming with the first encountered identical nucleotide

    • D-GENE choice (if several have the same score):
      • The less mutated one,
      • The longest one,
      • The one more upstream in the locus.

IMGT/JunctionAnalysis Results

The IMGT/JunctionAnalysis Results comprises:

Comparison between IMGT/JunctionAnalysis and IMGT/V-QUEST results

  1. The IMGT/JunctionAnalysis is by far a more accurate tool for the D-GENE and ALLELE name identification and delimitation. However, IMGT/V-QUEST has the advantage of proposing several solutions, which can be useful in some cases.
  2. The way IMGT/V-QUEST and IMGT/JunctionAnalysis identify the D-GENE is not identical, therefore the scores can be compared for a given tool, but score differences may be observed between the tools.
  3. For two D-GENE and ALLELE with an identical score in the IMGT/V-QUEST results, IMGT/JunctionAnalysis, in the default configuration selects the solution which gives the smallest N regions, or, in other terms, selects a longer D (accepting nucleotide differences) to a shorter D (without nucleotide differences).
  4. IMGT/JunctionAnalysis has been used for IMGT standardization for statistical analyses of T cell receptor TRAV-TRAJ junctions [8] and for recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J [9]. Protocol of IMGT/JunctionAnalysis has been published in Cold Spring Harb Protoc; 2011 [10].

Authors:

The first version of IMGT/JunctionAnalysis tool was developed by Mehdi Yousfi, student in the Licence d'Informatique, Université Montpellier II, during a stay in the Laboratoire d'ImmunoGénétique Moléculaire, IGH, CNRS, Montpellier, France.

IMGT/JunctionAnalysis in its present version has been developed by Denys Chaume, Véronique Giudicelli and Patrice Duroux.

References:

[1] Yousfi Monod, M. et al., Bioinformatics, 20, I379-I385 (2004) PMID:15262823 LIGM:289
[2] Lefranc, M.-P., Methods Mol. Biol., 248, 27-49 (2004) PMID:14970490 LIGM:277
[3] Lefranc, M.-P., Current Protocols in Immunology, pp. A.1W.1-A.1W.15 (2006) PMID:18432961 LIGM:311
[4] Giudicelli, V. and Lefranc, M.-P., Nova Science, pp77-105 (2005) LIGM :297
[5] Lefranc, M.-P. et al., Dev. Comp. Immunol., 27, 55-77 (2003) PMID:12477501 with permission from Elsevier LIGM:268
[6] Giudicelli, V. et al., Nucl. Acids Res., 32, W435-440 (2004) PMID:15215425 LIGM:287
[7] Pommié, C. et al., J. Mol. Recognit., 17, 17-32 (2004) PMID:14872534 LIGM:284
[8] Bleakley, K. et al., In Silico Biol., Epub 2006, 6, 0051, 6, 573-588 (2006). PMID:17518765 LIGM:319
[9] Bleakley, K. et al. BMC Bioinformatics, 9, 408 (2008).PMID: 18831754 PMID:18831754 LIGM:345
[10] Giudicelli, V., Lefranc, M.-P. Cold Spring Harb Protoc. 2011 Jun 1;2011(6): 716-725. pii: pdb.prot5634. doi: 10.1101/pdb.prot5634. PMID:21632777 IMGT booklet (high resolution) (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols). LIGM:389

Created: 31/08/2001
Last updated: 30/04/2020