IMGT®, the international ImMunoGeneTics information system®

anti-idiotype
anti-idiotype (A48: levan-specific BALB/c myeloma protein ABPC48)
anti-idiotype (Ab3) (anti-Neisseria meningitidis polysaccharide C)
anti-idiotype (anti-sigma receptor)
anti-idiotype (anti-tumor effect)
anti-idiotype > cocaine
anti-idiotype > cyclosporine (Cs)
anti-idiotype HLA class II
anti-idiotype [human]
anti-idiotype, anti-cancer [human]
anti-idiotype, anti-epidermal growth factor receptor

Total number of IG and TR genes
Number of functional IG and TR genes
Number of genes in the IMGT genome analysis tools

Potential germline repertoires
Questions and answers (IMGT Education): Nomenclature and overview of the human immunoglobulin genes
Questions and answers (IMGT Education): Nomenclature and overview of the human T cell receptor genes

1. the IG V gene sequences from a species with the human ones using IMGT/V-QUEST.
2. the IG V amino acid alignment with the human IGHV, IGKV and IGLV IMGT Protein display (germline sequences) to identify if unusual amino acids found in the analysed sequences are found in human V genes.
3. the IG V gene sequences from a species with the human IG productively rearranged V sequences (Pommié C. et al 2004 PMID:14872534).
   • How many of the 19 conserved positions (chemical characteristics in Table 2C and Table 3A of Pommié et al 2004) between human IGHV and IGKV/IGLV are conserved in the analysed sequences?
   • How many of the 41 conserved positions between human IGKV and IGLV (chemical characteristics in Table 2C and Table 3B- yellow+pink+light green) are conserved in the analysed sequences?
   • Are the specific positions in human IGKV or IGLV conserved in the analysed sequences? For human IGKV, for instance, the four specific positions are 7: hydroxyl, 24: basic, 86: acidic, and 87: F (Pommié C. et al 2004 PMID:14872534).
4. the IG V amino acid alignment with the human IGHV, IGKV and IGLV IMGT Protein display (germline sequences) to identify if unusual amino acids found in the analysed sequences are found in human V genes.

• the IMGT numbering is correct (Lefranc et al 2003 PMID:12477501)
• a space is added between the FR-IMGT and CDR-IMGT (between 26 and 27, between 38 and 39, between 55 and 56, between 65 and 66, between 104 and 105
• dots are added in all unoccupied positions according to the IMGT unique numbering (for example 33 to 38, 59 to 65, 73, 81,82, 112 to 117 for human IGKV genes)
• dashes are used for similarity (for the version in which only different amino acids are shown).
• the figure header is completed with FR1-IMGT, CDR1-IMGT, ...as in the example: Protein display: Human IGK V-REGIONs

• Total number of IG and TR genes
• Number of functional IG and TR genes
• Number of genes in the IMGT genome analysis tools
• The 3 other links lead to other pages:
  • Potential germline repertoires
  • Questions and answers (IMGT Education): Nomenclature and overview of the human immunoglobulin genes
  • Questions and answers (IMGT Education): Nomenclature and overview of the human T cell receptor genes

1. Cut at the end of the 3' V-REGION or at the 3' D-REGION (during the V-(D)-J rearrangement):

   5'  T - C - A - G
   3'  A - G - T - C
   

2. Link between G and C forming an hairpin:

   5'  T - C - A - G 3'  A - G - T - C

   }

3. Opening of the hairpin. If the cut occurs for instance between A and G on the upper strand:

   5'  T - C
   3'  A- G - T - C - G - A
   

4. The upper strand is completed. In the final sequence, C - T are designated as "P" nucleotides:

   5'  T - C - A - G - C - T
   3'  A - G - T - C - G - A
   

1. This numbering has been defined following extensive alignment analysis and taking into account the structural data.
   The rules for the IMGT unique numbering are described in: Lefranc, M.-P. et al. "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains". Dev. Comp. Immunol., 27, 55-77 (2003) PMID:12477501
2. The same IMGT unique numbering for V-DOMAIN is used whatever the species, whatever the receptor (IG or TR), and whatever the chain (IGH heavy, IGK kappa or IGL lambda, IGI iota in teleostei; TRA alpha, TRB beta, TRG gamma, TRD delta). Moreover, the IMGT unique numbering for V-DOMAIN is used, by extension, for the V-LIKE-DOMAIN of the immunoglobulin superfamily IgSF proteins.
   IMGT unique numbering for all IG and TR V-REGIONs of all species: interest for structure and evolution
   IMGT unique numbering for V-DOMAIN and V-LIKE-DOMAIN
3. In IMGT/3Dstructure-DB, for example, the CDR-IMGT lengths of 1hzh are, for the VH domain [8.8.20], and for the V-KAPPA domain [7.3.9].
   In the IMGT/3Dstructure-DB card, you can click and see the IMGT Colliers de Perles, on one or two layers. In the IMGT Collier de Perles on two layers, 3D structures experimentally determined hydrogen bonds are represented by green lines.
4. Correspondence between the Kabat numbering and the IMGT unique numbering are available in PMID:12477501 and on the IMGT site. For example: Correspondence between V numberings
5. Correspondence between the Chothia structures and the IMGT unique numbering are available on the IMGT site: FR-IMGT and CDR-IMGT lengths (V-REGION and V-DOMAIN)
6. Practically we only use the IMGT unique numbering (and have been using it for more than 8 years) as it allows to deal remarkably well with the sequences and structures. Moreover we have strong evolutionary data evidence that it is correct!

1. IMGT/V-QUEST uses the standardized IMGT nomenclature (gene name), which has been approved by the Human Genome (HUGO) Nomenclature Committee (HGNC) in 1999, and entered in LocusLink at NCBI in 2000, and now in Entrez Gene at NCBI (with direct links to IMGT/GENE-DB).
2. IMGT/V-QUEST uses the standardized amino acid (and codon) numberings, according to the IMGT unique numbering for V-DOMAIN.
3. IMGT/V-QUEST uses the delimitations of the frameworks (FR-IMGT) and complementarity determining regions (CDR-IMGT), which are identical whatever the receptor type (IG and TR) whatever the chain type and whatever the species. This is quite important when determining the number of IG mutations in the different regions.
4. At last, but not least, IMGT/V-QUEST provides the information by comparison to all the available alleles. This definition of the alleles represents a huge work but a very valuable one as it allows to take into account the germline diversity.

• Correspondence between labels for IG and TR domains in IMGT/3Dstructure-DB and IMGT/LIGM-DB
• Domain (domain definitions in IMGT Index)

• V-ALPHA: 1AO7DD00
• V-BETA: 1AO7ED00

• V-ALPHA: 1AO7DD00
• V-BETA: 1AO7ED00

• the V-ALPHA of the 3D structure but also of the corresponding rearranged cDNA sequence, amino acid sequence and protein 2D is referred to as Homo sapiens TRAV12-2-TRAJ24 [6.5.11].
• the V-BETA of the 3D structure but also of the corresponding rearranged cDNA sequence, amino acid sequence and protein 2D is referred to as Homo sapiens TRBV6-5-TRBD2-TRBJ2-7 [5.6.14].

1. either go the "Gene tables" in IMGT Repertoire
   For example, for a human IGHV gene, Gene table: human (Homo sapiens) IGHV in IMGT repertoire and "Find in This page" (Ctrl+F) the "previous" gene name (or its accession number, if known).
2. or Google "IMGT domain", on the IMGT Home page, with the "previous" gene name (or its accession number, if known), which lead you to "Alignments of alleles"
   For example: Alignment of alleles: human (Homo sapiens) IGHV4-34
   This approach is valid for any old name of genomic genes which are in the IMGT Repertoire (comprehensive for human and mouse).

1. A single nucleotide difference in the coding region (sequence polymorphism) is sufficient to define a new allele. IMGT allele nomenclature for sequence polymorphisms.
2. A different number of exons (polymophism by insertion/deletion) is also sufficient to define a new allele. For example, Homo sapiens IGHG3*11 and IGHG3*12 have identical genomic sequences for the coding regions they share, but they differ by the number of hinge exons. The IGHG3*11 allele has four hinge (H1, H2, H3, H4) exons, whereas the allele IGHG3*12 allele has three hinge exons (H1, H2, H4).
3. Can new alleles be submitted from NGS?
   'Putative' alleles identified by NGS from V-(D)-J rearrangements cannot be accepted as new alleles.
   They should be confirmed.
   Authors are strongly encouraged to confirm the nucleotide differences by genomic sequencing of the corresponding germline gene in order to keep an updated IMGT reference directory for the scientific community.

1. Following a query at NCBI (https://www.ncbi.nlm.nih.gov/) with an accession number (select Nucleotide), click on 'Links', then 'LinkOut', then 'The international ImMunoGeneTics database'.
2. Following a query at NCBI with an author (select PubMed), click on 'Links', then on 'Nucleotide' (if present), you will obtain the list of GenBank accession numbers associated to the abstract. For each result, click on 'Links', then 'LinkOut', then 'The international ImMunoGeneTics database'.

• V-REGION
• V-DOMAIN

>M99641|IGHV1-18*01|Homo sapiens|F|L-PART1+L-PART2|47..92+177..187
atggactggacctggagcatccttttcttggtggcagcaccaacaggtgcccactcc
>X60503|IGHV1-18*02|Homo sapiens|F|L-PART1+L-PART2|1..46+131..141
atggactggacctggagcatccttttcttggtggcagcagcaacaggtgcccactcc
>X07448|IGHV1-2*01|Homo sapiens|F|L-PART1+L-PART2|126..171+258..268
atggactggacctggaggatcctcttcttggtggcagcagccacaggagcccactcc
>X62106|IGHV1-2*02|Homo sapiens|F|L-PART1+L-PART2|21..66+152..162
atggactggacctggaggatcctcttcttggtggcagcagccacaggagcccactcc
>X92208|IGHV1-2*03|Homo sapiens|F|L-PART1+L-PART2|18..63+149..159
atggactggacctggaggatcctcttcttggtggcagcagccacaggagcccactcc
...

>M99641|IGHV1-18*01|Homo sapiens|F|L-PART1+L-PART2|47..92+177..187
MDWTWSILFLVAAPTGAHS
>X60503|IGHV1-18*02|Homo sapiens|F|L-PART1+L-PART2|1..46+131..141
MDWTWSILFLVAAATGAHS
>X07448|IGHV1-2*01|Homo sapiens|F|L-PART1+L-PART2|126..171+258..268
MDWTWRILFLVAAATGAHS
>X62106|IGHV1-2*02|Homo sapiens|F|L-PART1+L-PART2|21..66+152..162
MDWTWRILFLVAAATGAHS
>X92208|IGHV1-2*03|Homo sapiens|F|L-PART1+L-PART2|18..63+149..159
MDWTWRILFLVAAATGAHS
...

• to complete your sequence in the window with the CDR3 and the J (at least 9 or 10 amino acids beyond the F or W, respectively of the motif F/WGXG, to get the complete J)
• to add gaps (if the CDR3-IMGT is <13 amino acids), or additional positions (if the CDR3-IMGT is >13 amino acids).

1. Query Pubmed as usual to get publication abstracts http://www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed (type one accession number, e.g. X97469, or an author, etc..).
2. On the right of the abstract, click on "Links" and select "Nucleotide". You will get a list of GenBank accession numbers (with their definition) if sequences are described and quoted in the paper.
3. For each accession number, click on "Links" and select "LinkOut".

1. the results of IMGT/GeneFrequency,
2. the IMGT/GENE-DB tables of rearranged annotated cDNA and gDNA for each gene (at the bottom of each entry).

1. the J-PHE or J-TRP belongs to the characteristic J-REGION motif 'F/W-G-X-G' at positions 118-121
2. the CDR3 is delimited by the same anchor positions (2nd-CYS 104 and J-PHE or J-TRP 118), whatever the receptor type (IG or TR), the chain type (heavy or light for IG; alpha, beta, gamma or delta for TR) or the species.

1. In the IMGT/GENE-DB Query page, use SHORT CUT: Select the 'Species' and type the 'IMGT gene name', then 'do the search'.
2. In the resulting page, select the gene, then 'Do the search'.
3. At the bottom of the IMGT/GENE-DB entry, you will find links to tables displaying lists of annotated IMGT/LIGM-DB cDNA and rearranged gDNA, using that gene.

You can access the same tables starting from the IMGT/GENE-DB Query page:
Click on 'IMGT/GENE-DB direct links for a given gene' (at the bottom of the Query page), and then in the resulting page select the appropriate format:

• For cDNA: http://www.imgt.org/genedb/GENElect?query=12.1+Genesymbol&species=Species
  example:
  • http://www.imgt.org/genedb/GENElect?query=12.1+IGHV1-2&species=Homo+sapiens


• For rearranged gDNA: http://www.imgt.org/genedb/GENElect?query=12.2+Genesymbol&species=Species
  example :
  • http://www.imgt.org/genedb/GENElect?query=12.2+IGHV1-2&species=Homo+sapiens

1. Query IMGT/GENE-DB
   Example: Species: 'Homo sapiens', Group: 'IGHV', Functionality: 'Functional'
   Do the search
2. In the result page:
   Select all genes
   then at the bottom of the page in: IMGT label extraction from IMGT/LIGM-DB reference sequences
   Choose label(s) for extraction
   V-RS

1. Query IMGT/GENE-DB
2. Select :
   • Gene type: constant
   • Group: IGHC
3. Do the search.
   In the resulting page, you will get a list of 52 genes. Select manually the IGHA, IGHD and IGHG genes of interest.
4. Click on the radio button of 'Choose label for extraction'. Select H, H1, H2, H3, H4 (together).
5. Click on the radio button of: 'Amino acid sequences' (see results below after selecting all IGHA, IGHD and IGHG).
   You can do the same kind of query for nucleotide sequences: Click on the radio button of: 'Nucleotide sequences'.

J-REGION [740..777]
gtggacgttcggtggaggcaccaagctggaaatcaaac
W  T  F  G  G  G  T  K  L  E  I  K

J-REGION [1094..1132]
tgtacacgttcggaggggggaccaagctggaaataaaac
Y  T  F  G  G  G  T  K  L  E  I  K

1. The definition of the IMGT label "J-REGION" includes the additional 1 or 2 nucleotides that can be found following the J-HEPTAMER. Indeed these nucleotides can be found in V-(D)-J junctions when the rearrangement occurs without trimming of the J region.

   IMGT label definition:
   J-REGION: coding region of J-GENE (plus 1 or 2 nucleotide(s) after J-HEPTAMER, if present) or corresponding region in cDNA
   

   In genomic sequences J-HEPTAMER and J-REGION are therefore be contiguous (numbers in green below).
2. As these additional nucleotides are taken into account in IMGT, "codon_start" is added to indicate on which nucleotide (nt), in the IMGT coding label, should start the translation by automatic tools: codon_start=2 means that it is the 2nd nt (the "t" of tgg) for IGKJ1*01 codon_start=3 means that it is the 3rd nt ("t" of tac) for IGKJ2*01. These nucleotides are shown in bold in the sequences above.

   FT J-HEPTAMER 733..739
   FT J-REGION 740..777
   FT /note="functional"
   FT /allele="IGKJ1*01"
   FT /gene="IGKJ1"
   FT /codon_start=2
   FT /translation="WTFGGGTKLEIK"
   
   FT J-HEPTAMER 1087..1093
   FT J-REGION 1094..1132
   FT /note="functional"
   FT /allele="IGKJ2*01"
   FT /gene="IGKJ2"
   FT /codon_start=3
   FT /translation="YTFGGGTKLEIK"
   

1. To get the complete amino acid sequence (artificially spliced) of a reference constant gene, the query is 13.2
   • http://www.imgt.org/genedb/GENElect?query=13.2+Genesymbol&species=Species
     with for Genesymbol, the gene name (for instance IGHG1), and for Species, the latin name of the species (for instance Homo+sapiens) http://www.imgt.org/genedb/GENElect?query=13.2+IGHG1&species=Homo+sapiens
2. To get the artificially spliced nucleotide sequence of that gene, the query is 13.1
3. To get the complete amino acid sequence (artificially spliced) of reference constant genes of a group, the query is 14.2
   • http://www.imgt.org/genedb/GENElect?query=14.2+Group&species=Species
     with for Group, the group name (for instance IGHC), and for Species, the latin name of the species (for instance Homo+sapiens) http://www.imgt.org/genedb/GENElect?query=14.2+IGHC&species=Homo+sapiens
4. To get the artificially spliced nucleotide sequence of that group, the query is 14.1

1. query IMGT/GENE-DB
   • Example: Species: Homo sapiens, Group: IGHV, Functionality: Functional
   • Do the search.
2. In the result page:
   • Select all genes
   • then at the bottom of the page in: 'IMGT label extraction from IMGT/LIGM-DB reference sequences'
   • 'Choose label(s) for extraction':
     • V-RS.
     • For J genes: the label is J-RS
     • For D genes: the labels are 5'D-RS and 3'V-RS.

Information to be provided

The information to be provided comprises, for each gene:
1) the public accession number of the clone from which the sequence was extracted (or of the NCBI assembly positions and version), with the proposed gene name (provisional), positions start and end in that accession number,
2) the corresponding sequence in FASTA format:
- for V genes: from the beginning of the L-PART1 (atg) to the 3'end of the V-RS
- for D genes: from the 5' end of the 5'D-RS to the 3' end of the 3'D-RS
- for J genes: from the 5' end of the J-RS to the 3'end of the J-REGION
- for C genes: from the 5' end of the first exon to the 3' end (stop codon) of the last exon.
3) the proposed functionality (F, ORF, P), and comments (any comment which can be useful, for example, why a gene is considered 'ORF' or 'P')
4) additionally, for V genes,
- the CDR-IMGT lengths (the germline CDR3-IMGT includes, if present, the one or two nucleotides upstream of the V-HEPTAMER)
- the closest human V-REGION gene and allele with score, percentage of identity and alignment length ratio, as provided by IMGT/V-QUEST.
For pseudogenes, the above information obtained using the option 'Search for insertions and deletions in V-REGION', with summary of the out-of-frame defects (for example, '1 del (1), 2 ins (1,2)' for one deletion of 1 nucleotide (nt), 2 insertions of 1 nt and 2nt).

IG and TR subgroup numbers

The IG and TR subgroup numbers are assigned, whenever it is possible, by comparison to the Homo sapiens subgroups (V-REGION nucleotide sequence identity >75% for functional and ORF genes and, for information, CDR-IMGT lengths). This means that some Homo sapiens subgroup numbers may not be represented in some species or conversely that new numbers may be added for subgroups not represented in Homo sapiens.

IG and TR gene numbers.

• º For the IG, the gene numbers indicate the localization in the locus, irrespective of the subgroups. The gene numbers increase from 3' in the locus (downstream, next to the D and/or J genes) to 5' in the locus (upstream).
  Ex: Homo sapiens IGH. http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=locus&species=human&group=IGH
• º For the TR, the gene numbers indicate the respective localization, in the locus, of genes belonging to a given subgroup. The gene numbers increase for a given subgroup from 5' in the locus (upstream) to 3' in the locus (downstream, next to the D and/or J genes).
  Ex: Homo sapiens TRB. http://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=locus&species=human&group=TRB

More information

Lefranc M-P. Immunoglobulin (IG) and T cell receptor genes (TR): IMGT® and the birth and rise of immunoinformatics. Front Immunol. 2014 Feb 05;5:22. doi: 10.3389/fimmu.2014.00022. Open access. PMID:24600447